ID: 1028869768

View in Genome Browser
Species Human (GRCh38)
Location 7:95756799-95756821
Sequence CAGAAAAGGGACAGGTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028869768_1028869773 11 Left 1028869768 7:95756799-95756821 CCTGACTACCTGTCCCTTTTCTG No data
Right 1028869773 7:95756833-95756855 TTTATTTGGAACTTCTTCCCAGG No data
1028869768_1028869772 -3 Left 1028869768 7:95756799-95756821 CCTGACTACCTGTCCCTTTTCTG No data
Right 1028869772 7:95756819-95756841 CTGTTTGTTTTCTGTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028869768 Original CRISPR CAGAAAAGGGACAGGTAGTC AGG (reversed) Intergenic
No off target data available for this crispr