ID: 1028872710

View in Genome Browser
Species Human (GRCh38)
Location 7:95786761-95786783
Sequence GGGGCCAAGGGGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1709
Summary {0: 1, 1: 0, 2: 14, 3: 172, 4: 1522}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028872710_1028872725 28 Left 1028872710 7:95786761-95786783 CCATCCTCCTTCCCCTTGGCCCC 0: 1
1: 0
2: 14
3: 172
4: 1522
Right 1028872725 7:95786812-95786834 TGTAGCAGGGACTGGAGCAGTGG 0: 1
1: 0
2: 24
3: 63
4: 454
1028872710_1028872722 14 Left 1028872710 7:95786761-95786783 CCATCCTCCTTCCCCTTGGCCCC 0: 1
1: 0
2: 14
3: 172
4: 1522
Right 1028872722 7:95786798-95786820 GCAAAGTGTCACAGTGTAGCAGG No data
1028872710_1028872727 30 Left 1028872710 7:95786761-95786783 CCATCCTCCTTCCCCTTGGCCCC 0: 1
1: 0
2: 14
3: 172
4: 1522
Right 1028872727 7:95786814-95786836 TAGCAGGGACTGGAGCAGTGGGG 0: 1
1: 0
2: 2
3: 37
4: 421
1028872710_1028872723 15 Left 1028872710 7:95786761-95786783 CCATCCTCCTTCCCCTTGGCCCC 0: 1
1: 0
2: 14
3: 172
4: 1522
Right 1028872723 7:95786799-95786821 CAAAGTGTCACAGTGTAGCAGGG 0: 1
1: 1
2: 1
3: 13
4: 166
1028872710_1028872726 29 Left 1028872710 7:95786761-95786783 CCATCCTCCTTCCCCTTGGCCCC 0: 1
1: 0
2: 14
3: 172
4: 1522
Right 1028872726 7:95786813-95786835 GTAGCAGGGACTGGAGCAGTGGG 0: 1
1: 0
2: 3
3: 35
4: 361
1028872710_1028872724 20 Left 1028872710 7:95786761-95786783 CCATCCTCCTTCCCCTTGGCCCC 0: 1
1: 0
2: 14
3: 172
4: 1522
Right 1028872724 7:95786804-95786826 TGTCACAGTGTAGCAGGGACTGG 0: 1
1: 0
2: 2
3: 9
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028872710 Original CRISPR GGGGCCAAGGGGAAGGAGGA TGG (reversed) Intronic
900349696 1:2228587-2228609 GGCGCGAAGGGGAAGGCGGGCGG - Intergenic
900357816 1:2273219-2273241 GGCGCCAGTGGGAAGGAGGAGGG - Intronic
900367709 1:2318038-2318060 GGGGTCAAGTGGAAGGATGGGGG - Intergenic
900407313 1:2498387-2498409 GGTGCCAGGGGGAGGGAGGGAGG - Intronic
900499383 1:2993355-2993377 GGGGCCTATGGGAGGGTGGAGGG + Intergenic
900503223 1:3016688-3016710 GGGAGCCAGGGGAGGGAGGAAGG + Intergenic
900509212 1:3050523-3050545 GGGGCCCAGGAGAATGAAGATGG + Intergenic
900531255 1:3154559-3154581 GGGGCCAAGGGAAAGTGGGAAGG - Intronic
900564587 1:3326037-3326059 GGGGCCAAGAGGGCCGAGGATGG - Intronic
900600049 1:3499033-3499055 GGTGCCTGGGGGAGGGAGGAAGG - Intronic
900631528 1:3638828-3638850 GGGGGAAAGGGGAAAGAGAAAGG + Intronic
900703658 1:4062900-4062922 GAGGCCAGGGGAGAGGAGGACGG - Intergenic
900917895 1:5651173-5651195 GGGCACACAGGGAAGGAGGAAGG + Intergenic
900994432 1:6112801-6112823 GGGGCCAAGGGGACGGCGCCTGG + Intronic
901058850 1:6462362-6462384 GGGGACAAGAGGAAGGAGGCGGG - Intronic
901137425 1:7007097-7007119 AGGGCCAAGGGGATGGATGATGG + Intronic
901234711 1:7661645-7661667 GGGGCCAAGGGGTAGGACCCAGG - Intronic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901462865 1:9401915-9401937 GGGGCGAAGGGGAGGGAGGGAGG + Intergenic
901536141 1:9883981-9884003 GAATCCATGGGGAAGGAGGAAGG + Intronic
901556177 1:10033005-10033027 GGGGCGAGGGGGAAAGAGTAGGG + Intronic
901628163 1:10635156-10635178 GGGGCCCAGGGGAGGGAGAATGG - Intergenic
901741560 1:11345299-11345321 GAGGCCACGGGGAAGGAGGTGGG + Intergenic
902113096 1:14099362-14099384 GGGAACCAGGGGAATGAGGAAGG - Intergenic
902114092 1:14106937-14106959 GGAGGGAAGGGGAAGGAGGGAGG - Intergenic
902214443 1:14925230-14925252 GGGGGGAAGGGGCAGGGGGAAGG - Intronic
902407272 1:16191635-16191657 GGGACCAGGAGGAATGAGGAGGG + Intergenic
902582911 1:17420124-17420146 GGGTCCGATGGGAAGGAGAATGG + Intronic
903018905 1:20379908-20379930 GGGGCCAAGGGGCTGGGGGGTGG - Intergenic
903019995 1:20387044-20387066 AGGGCTGAGGGGGAGGAGGAAGG + Intergenic
903116287 1:21181167-21181189 GGGCCCCAGGGCAAGGAGAATGG - Intergenic
903210433 1:21814960-21814982 GGGTCCAACGGGAGGGAAGAAGG + Intronic
903291564 1:22317487-22317509 GGGGCCAGGAGGAAGGGGGCTGG + Intergenic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903438689 1:23371067-23371089 GGGGCAAAGGGGTGGGGGGAAGG - Exonic
903590320 1:24450744-24450766 CAGGCCACGGGGAAGGAAGATGG - Intronic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904044839 1:27603047-27603069 GGAGGGAGGGGGAAGGAGGAGGG + Intronic
904046980 1:27614977-27614999 GGGGTCAAGCGAGAGGAGGAGGG - Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904295747 1:29518784-29518806 GGAGAAAAGGAGAAGGAGGAAGG - Intergenic
904301362 1:29556781-29556803 GGGGACAAGTGGAGGGAGGCAGG + Intergenic
904339984 1:29828316-29828338 GGGGACAAGTGGAGGGAGGTGGG + Intergenic
904448776 1:30597761-30597783 GGATCCAAAGGGAAGGAGTAAGG - Intergenic
904472604 1:30745432-30745454 GGGGCTGAGGGGAGGGAGGGGGG - Intronic
904625420 1:31799517-31799539 GGTGCCCAGGGGAAAGGGGAGGG + Intronic
904873221 1:33634840-33634862 GTGGCCAAGGAGCAGGAGGGAGG - Intronic
904941731 1:34168393-34168415 GGGGGCCAGGAGGAGGAGGATGG + Intronic
905625985 1:39491143-39491165 GGGGCCACGGGGAAGGCGCCAGG + Intergenic
905657115 1:39692125-39692147 GGGTCCATGAGAAAGGAGGAGGG - Intergenic
905799942 1:40837041-40837063 GGGGAAAAGGGGAAAGAGGATGG - Intronic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
905891006 1:41518359-41518381 GCGGACAAGGGGAAAGGGGACGG + Intronic
906006076 1:42471665-42471687 GGGGACCAGGTGAAGGAGGTCGG + Intronic
906118924 1:43374533-43374555 GGGGGCAAGGGGCAGGGGGATGG + Intergenic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906316025 1:44786847-44786869 GAGGCCAGGAGGAGGGAGGAGGG + Intronic
906658289 1:47564631-47564653 GGGGCCTGGGAGAAGGAGGAGGG - Intergenic
906843577 1:49165775-49165797 GGAGGGAAGGGGATGGAGGAAGG + Intronic
907049802 1:51322222-51322244 GAGGCCTTGGAGAAGGAGGAGGG - Intronic
907062906 1:51449426-51449448 GGGGCCAATGTGAGGGTGGAGGG + Intronic
907170175 1:52455666-52455688 GGGGGGAGAGGGAAGGAGGAAGG + Intronic
907400532 1:54222313-54222335 AGGGCAAGTGGGAAGGAGGAGGG + Intronic
907716142 1:56928000-56928022 GGGGCCATGGGGATGCGGGAAGG + Intergenic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907847297 1:58220485-58220507 GGGGCTGGGGGGAAGGTGGAAGG + Intronic
908003723 1:59707382-59707404 GAGGCCAAGCTGTAGGAGGAGGG + Intronic
908603598 1:65768254-65768276 GGGGCCTATGGGAGGGTGGAAGG - Intergenic
909227236 1:73041508-73041530 TGGGGCAAGAGGCAGGAGGATGG - Intergenic
909685094 1:78339178-78339200 GGGGCCAAGGAGGATAAGGAGGG - Intronic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
910508476 1:87977314-87977336 GCTGCCAGGGGAAAGGAGGATGG - Intergenic
910753053 1:90655140-90655162 GGGGCCTACTGGAAGGTGGAGGG + Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911100845 1:94094754-94094776 GGGGAAGAGGGGGAGGAGGAGGG + Intronic
911741634 1:101392559-101392581 GAGGGCAAGAGGAAGGAGGGAGG - Intergenic
912432280 1:109635003-109635025 GGGGTGAGGGGGAAGGAGGGTGG + Intergenic
912432972 1:109639220-109639242 GGGGCAAGGTGGAAGGAGGAGGG + Intergenic
912449494 1:109760481-109760503 GGGGTCAAAGGGCAGGAGGCAGG - Intronic
912508326 1:110171850-110171872 GGAGTCAAGGGGGAGAAGGAGGG + Intronic
912587686 1:110781404-110781426 AGGACCAAGGGGCTGGAGGAAGG - Intergenic
912711453 1:111952828-111952850 AGAGACAAGGGGATGGAGGAGGG + Intronic
913048697 1:115096131-115096153 GGGGCCTATAGGAAGGTGGAAGG - Intergenic
913203731 1:116517040-116517062 AGGGCCACGGGGAAAGGGGATGG - Intronic
913222030 1:116667560-116667582 GGGGCCCCGGGGAGGGAGGCGGG - Intronic
913451263 1:118994185-118994207 GGGGCCAAGTGGGAGCAGCAGGG + Intergenic
914918392 1:151831822-151831844 AGGGCCCAGGGGAGGGAGGAGGG + Exonic
914942768 1:152037204-152037226 GGGGCCGGGGGGAAAGAGGAGGG - Intronic
914964570 1:152243241-152243263 GGAGCCAAGAGAAAGAAGGAAGG + Intergenic
915167768 1:153958178-153958200 AGGGCCGAGGGGCAGGAAGAAGG - Intronic
915259217 1:154664222-154664244 GGGGCCAAGGAGAGGGAGAAAGG - Intergenic
915524232 1:156466436-156466458 GGCGCCAAGAGCAAGGAGGTGGG + Exonic
915558611 1:156673991-156674013 GGGCCACCGGGGAAGGAGGAGGG - Intronic
915596536 1:156899579-156899601 GGCGCCAAGGGGAGGGCGGATGG + Intronic
915616409 1:157042951-157042973 GAGGCCAACAGAAAGGAGGAAGG + Intronic
915624512 1:157106526-157106548 GGGGACAAAGGGAAGGATCAGGG - Intergenic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916046679 1:161005282-161005304 GGGAGGGAGGGGAAGGAGGAAGG - Intronic
916213597 1:162377680-162377702 TGGGGCAGGGGGCAGGAGGAAGG - Intronic
916295716 1:163217072-163217094 GGGGCCTACTTGAAGGAGGAGGG + Intronic
916501603 1:165392378-165392400 GTGGCCCAGTGGAAGGAGCAGGG - Intergenic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916717901 1:167460729-167460751 GGGGTCAGGGGGCTGGAGGAGGG - Intronic
917030604 1:170686365-170686387 GGGGCGTAGGGGAAGCAGAAGGG + Intronic
917714186 1:177717394-177717416 GGGGGCAGGGGGCAAGAGGAGGG + Intergenic
917817341 1:178724925-178724947 GGGGGGAAGGGGTAGGAGGATGG - Intergenic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
917929167 1:179812183-179812205 GGGACCAAGGGGCAGGAGGGTGG - Intronic
918082821 1:181220833-181220855 GGGGCCAGAGGGAAGGACAAAGG - Intergenic
918093494 1:181316793-181316815 GGAGTCACAGGGAAGGAGGAGGG - Intergenic
918237441 1:182593923-182593945 GGAGCCAGAGGGAAGGAGGAAGG - Intergenic
918332344 1:183472371-183472393 GGGGGGAGGGGGAGGGAGGAGGG - Intronic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919353136 1:196485303-196485325 GGGGGCGAGGGGAAGGAAAATGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
920016178 1:202911285-202911307 GTGGGCAATGGGAAGCAGGAAGG - Intronic
920095558 1:203484179-203484201 GGGGCCGAAGGCAAGGAGGTTGG + Intronic
920112858 1:203599308-203599330 AGGGTCTAGGGGAAGGAGAAAGG - Intergenic
920255614 1:204652225-204652247 AGGGCGAAGGGGAGAGAGGAGGG - Intronic
920285520 1:204875932-204875954 GGGGAAAAGTGGAAGGAGGAGGG + Intronic
920374878 1:205502894-205502916 GGGGACAAGAGAGAGGAGGAAGG - Intergenic
920386945 1:205576103-205576125 GGGGACAAGAGGTAGGAGCAGGG + Intronic
920441111 1:205980865-205980887 GAGGTGAAGGGGAAGGGGGAGGG - Intronic
920822708 1:209396220-209396242 GGGGCCAGGGGTCAGCAGGAGGG + Intergenic
921006515 1:211099543-211099565 GGGGCGGAGGGGAGGAAGGAGGG - Intronic
921177236 1:212606201-212606223 GGGGCTGAGGGGAGGGAGGCAGG + Intronic
921182981 1:212645967-212645989 GGGGCCAGTGGGGAGGAGGCTGG + Intergenic
921218457 1:212956317-212956339 AGGGCTAGGGGGCAGGAGGAGGG - Intronic
921297875 1:213721852-213721874 GGGGGCAGGGGCAGGGAGGAAGG - Intergenic
921515960 1:216092931-216092953 GGGGCTAAAGGGAGTGAGGAAGG - Intronic
921586592 1:216953565-216953587 AGGGCCAAGAGGGAGGATGAAGG - Intronic
922061254 1:222094564-222094586 GAAGCCATGGAGAAGGAGGATGG - Intergenic
922355123 1:224767993-224768015 TGGGGCTGGGGGAAGGAGGAGGG + Intergenic
922427706 1:225514805-225514827 GGGGCCCTGGGGGAGGAGGGAGG + Exonic
922480442 1:225936955-225936977 GGTGCTAAGAGGAAGGATGAAGG - Exonic
922724989 1:227918461-227918483 GGGACCAGGGAGGAGGAGGAAGG - Intergenic
922820137 1:228479146-228479168 GGGGCCAAGGGAGAAAAGGAAGG - Intergenic
923051374 1:230393254-230393276 AGGGAAAAGGGGGAGGAGGAGGG + Intronic
923482467 1:234397493-234397515 GGGGGGAAGGGGGAGGGGGAAGG + Intronic
923526341 1:234775662-234775684 GGGGCCCCAGGGAAGTAGGACGG + Intergenic
923536736 1:234858251-234858273 GGGTCCAGGGAGGAGGAGGATGG - Intergenic
923756695 1:236797364-236797386 TGTGCCCTGGGGAAGGAGGATGG + Intronic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924349887 1:243104469-243104491 GGGGACAAAGGGAAGAAGCAGGG + Intergenic
924371825 1:243359132-243359154 GTCACCAAGAGGAAGGAGGAAGG - Intronic
924940431 1:248809657-248809679 GGGGTCAAGGGGCAGGGTGAAGG - Intergenic
1062818440 10:516836-516858 GGGGACAGGGGGATGGGGGAGGG + Intronic
1062833901 10:623745-623767 AGGGCCAAGGGGAAGAGGGGAGG + Intronic
1063245306 10:4211736-4211758 TGGGCCGAGGAGGAGGAGGAAGG + Intergenic
1063309694 10:4940612-4940634 GGGGTGAAGGGAAGGGAGGAAGG + Intronic
1063317596 10:5021489-5021511 GGGGTGAAGGGAAGGGAGGAAGG - Intronic
1063400321 10:5737507-5737529 GGGCCGCAGGGGAAGGAGCACGG - Intronic
1064272683 10:13879729-13879751 GGGGAGAAGGGAGAGGAGGAGGG - Intronic
1064354793 10:14606700-14606722 GGGACAGAGGGGAAGGAGGGAGG - Intronic
1064376356 10:14800065-14800087 GGGACCAATGGCAAGGAGGTTGG + Intergenic
1064376470 10:14800992-14801014 GGGACCAATGGCAAGGAGGTTGG - Intergenic
1064859941 10:19816129-19816151 GGAGCGAAGGGGAGGGCGGAGGG + Intergenic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065020122 10:21496273-21496295 GGGGCCGGGGGAAAGGGGGACGG - Intronic
1065354513 10:24826985-24827007 GGTGCAGAGGGGAAGTAGGAGGG - Intergenic
1065732772 10:28724305-28724327 TGGGCCAATGGGAAAGAGGTTGG + Intergenic
1065791552 10:29265020-29265042 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
1065947851 10:30623825-30623847 GTGGACGAGGGGGAGGAGGATGG - Intronic
1066342739 10:34551743-34551765 GTGGCCATGGGGAAGGAGAGAGG + Intronic
1066506270 10:36048019-36048041 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
1066585939 10:36935576-36935598 GGGGCCAATAGGATGGTGGAGGG - Intergenic
1066698367 10:38099286-38099308 GTTGCCAGGGGCAAGGAGGAAGG - Intronic
1066994149 10:42547865-42547887 GTTGCCAGGGGCAAGGAGGAGGG + Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067142966 10:43671587-43671609 GGGCGCAAGGGGAAGGAAGGAGG - Intergenic
1067270994 10:44791220-44791242 AGAGCAAGGGGGAAGGAGGAGGG - Intergenic
1067299775 10:44997796-44997818 GGTGCAAAGGGGAAGGAGTATGG - Exonic
1067306079 10:45065269-45065291 GTGGCCAAGGGGCCGGAGGCAGG - Intergenic
1067342634 10:45417945-45417967 GGGGCCAAGGGCAGGGTGGGCGG - Intronic
1067473884 10:46553950-46553972 GGAGCCAGGGGTGAGGAGGAAGG + Intronic
1067530269 10:47066072-47066094 GGGGCCCAGGGCAAGGAGCAGGG - Intergenic
1067530906 10:47072053-47072075 GGGGCCATGGGGAGGGAGAAAGG - Intergenic
1067787123 10:49258565-49258587 GGGGCCAGGAAGAAAGAGGAGGG + Intergenic
1067790715 10:49285488-49285510 AGGGCCTGGGGGAAGGAGGATGG + Intergenic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1068216436 10:53988342-53988364 GAGGCCGAGGGGATGGGGGAGGG + Intronic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068777863 10:60887615-60887637 AGGGCCAAGGAGCATGAGGACGG + Intronic
1069599578 10:69694819-69694841 GGGGCCAAGGGGAATCTGGTAGG - Intergenic
1069667027 10:70169865-70169887 GGGGAAAAGGGGAAGGGAGAAGG + Intronic
1069718294 10:70534494-70534516 GGTGCCCCAGGGAAGGAGGATGG + Exonic
1069834273 10:71299021-71299043 GGGCACAAGGGGAAGTGGGAAGG - Intronic
1069963159 10:72090656-72090678 GAGGCCAAGAGGCAGGAGGATGG + Intergenic
1069973967 10:72198062-72198084 GGGGGGAGGGGGAACGAGGAAGG + Intronic
1069982365 10:72261184-72261206 GGGGCCAGCGGGATGGGGGAAGG - Intergenic
1070596451 10:77835928-77835950 GGGAGCAAGGGGCAGGAAGAGGG + Intronic
1070679781 10:78440460-78440482 GGGGCCTAGGGAGAGGTGGATGG - Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070731761 10:78833682-78833704 CGGGTCAAGGGGCAGGAGGGAGG - Intergenic
1070846808 10:79529604-79529626 GGGGCCTATGGGAAGATGGAGGG - Intergenic
1070926991 10:80230663-80230685 GGGGCCTATGGGAAGATGGAGGG + Intergenic
1071524052 10:86347959-86347981 GGGACCATGGGGAAGGTGGCCGG - Intronic
1071532720 10:86401508-86401530 AGGTCCAAGGGGAAGAAAGAGGG - Intergenic
1071720937 10:88145594-88145616 AGGGAAAAAGGGAAGGAGGAAGG - Intergenic
1072047879 10:91674851-91674873 CCAGCCAATGGGAAGGAGGAAGG - Intergenic
1072195739 10:93116039-93116061 GGGGAGGAGGGGGAGGAGGAGGG + Intergenic
1072446446 10:95502898-95502920 GAGGCCAAAGGAGAGGAGGAGGG - Intronic
1073069072 10:100781955-100781977 GGTGTCAAAGGGAAGGGGGAAGG + Intronic
1073123413 10:101135301-101135323 CGGGCCTTGGGGCAGGAGGAAGG + Intronic
1073378079 10:103054175-103054197 GATGCCACGGGGAAGGAGGGAGG - Intronic
1073477251 10:103762497-103762519 GGGGGCAAGGGGTAGAGGGAAGG - Intronic
1073480334 10:103782658-103782680 GGGGAGAAGGGGAGGGAGGTGGG + Intronic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1074163755 10:110857020-110857042 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
1074278134 10:112024200-112024222 GTGGCCAAGAAGATGGAGGAAGG - Intergenic
1074326389 10:112455339-112455361 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1074547288 10:114410862-114410884 GGGGCTAGGGAGAAGGAGAATGG - Intergenic
1075015642 10:118908441-118908463 GGGGGCTGGGGGAGGGAGGAAGG - Intergenic
1075122690 10:119675850-119675872 GGGGCAAGGGGGAAGGGGGCAGG - Intronic
1075153234 10:119953703-119953725 GGGGGCAAGGAGGAAGAGGAAGG - Intergenic
1075192408 10:120321846-120321868 GGGGCCATGAGGAAGGTGGAGGG + Intergenic
1075263931 10:120984857-120984879 GGGGCCAAGGGGGAGGTGATTGG - Intergenic
1075273445 10:121073174-121073196 GAGGCAAAAGGAAAGGAGGAAGG + Intergenic
1075424617 10:122332025-122332047 GGGGACAAAAGGAAGGAGGTGGG - Intronic
1075433906 10:122417294-122417316 GGGGGCGAGGAGTAGGAGGAAGG + Intronic
1075775597 10:124984046-124984068 GGCGGCAGGGGGAGGGAGGAAGG + Intronic
1075798005 10:125134875-125134897 GGGGGCAGGGGGCAGGAGGCAGG - Intronic
1075942978 10:126407190-126407212 GGGTCCAAAGAGCAGGAGGAAGG + Intergenic
1076109800 10:127851683-127851705 GTGCCCCAGGGGAAGGAGGCAGG + Intergenic
1076306196 10:129467176-129467198 GGGGCCGAGGGGCACGGGGATGG - Exonic
1076328512 10:129646923-129646945 GGGCCAGAGGGGAAAGAGGACGG - Intronic
1076668262 10:132104981-132105003 GGGCCCCAGGGGAGGCAGGAGGG - Intronic
1076728081 10:132422525-132422547 GGGGCCAGGAGGGAGGGGGATGG - Intergenic
1076778094 10:132709276-132709298 GGGGAGGAGGGGGAGGAGGAGGG + Intronic
1076798328 10:132809460-132809482 GGGAGCGAGGGGCAGGAGGAAGG - Intronic
1077066051 11:641320-641342 TGGGCCAAGGGGTGGGAGCAGGG + Intergenic
1077093303 11:789139-789161 GGGTCCCAGGGGGAGGAGGGCGG + Intronic
1077167562 11:1150630-1150652 GGGGCCGAGGGGTGGGGGGAGGG + Intergenic
1077249472 11:1554622-1554644 AGGGACAAGGGGAAGGGGGAAGG + Exonic
1077258298 11:1599713-1599735 GGGAACAAGAGGAGGGAGGAAGG + Intergenic
1077269378 11:1668058-1668080 GGGGGAGAGGGGAAGGAGGGAGG - Intergenic
1077417447 11:2431301-2431323 GGGGCCCTGGGCAAGGCGGAGGG + Intergenic
1077463326 11:2721833-2721855 GGGGCCAAGGGACAGATGGATGG - Intronic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1077546914 11:3175904-3175926 GTGGCCAGGGGGAGGGAGAAGGG + Intergenic
1077632092 11:3817639-3817661 AGGGACAAGGGGATGGGGGAAGG + Intronic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077779262 11:5307648-5307670 GGGGGAAGGGGGAAGGGGGAGGG - Intronic
1077806579 11:5596526-5596548 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1077806583 11:5596533-5596555 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1078101638 11:8333723-8333745 GGAGGCTGGGGGAAGGAGGAGGG + Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078390451 11:10931685-10931707 GAGGCCAAGGGGACAGGGGAGGG + Intergenic
1078480202 11:11668794-11668816 GGGACCATGGGGAAGATGGAGGG + Intergenic
1078617251 11:12877741-12877763 GGAGAAAAGGGGAAGGAGGAAGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079093456 11:17496127-17496149 GGGATGAAGGGGAAGGAGGGGGG + Intronic
1079240602 11:18719889-18719911 GTGCCCTAGGAGAAGGAGGAAGG + Exonic
1079898611 11:26152429-26152451 GGGGGGGAGGGGAGGGAGGAAGG + Intergenic
1080628664 11:34052749-34052771 TGGGCCAGGGGGTGGGAGGAGGG - Intronic
1080767035 11:35306670-35306692 GGGGGAAAGGGGAAGGACGAAGG - Intronic
1080814547 11:35741575-35741597 GGGCCCAAGAGGAAGGGGCATGG + Intronic
1080850604 11:36065989-36066011 GGAGCCAAGGGGATGGGAGAGGG + Intronic
1080884319 11:36352503-36352525 GGGGAAAGGGGGAAGGAGTAAGG - Intronic
1081296212 11:41392811-41392833 GTGGCCCAGAGGAAGCAGGAAGG + Intronic
1081316196 11:41633653-41633675 GGGGCCTATTGGAAGGTGGAGGG - Intergenic
1081392194 11:42542282-42542304 GGGCACAAAGGGAAGGGGGAGGG - Intergenic
1081623763 11:44634722-44634744 GGGAGGGAGGGGAAGGAGGAGGG - Intergenic
1081731636 11:45375927-45375949 GGGGCGCAGGGGCAGGAGGTGGG + Intergenic
1081731717 11:45376443-45376465 GGGGAGCAGGGGAAAGAGGAGGG - Intergenic
1081801564 11:45863243-45863265 TGGGCCAAGGGGCAGAAGGGTGG + Intronic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1082207985 11:49462252-49462274 GGGGGGAGGGGGAAGGGGGAGGG - Intergenic
1082244431 11:49905189-49905211 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1082244439 11:49905202-49905224 AGGGGGAAGGGGAAGGAGGGGGG + Intergenic
1082244481 11:49905299-49905321 GGGGGAAGGGGGAAGGGGGAGGG + Intergenic
1082626132 11:55488452-55488474 GGGGCTAAGGGGAAGGGATAAGG - Intergenic
1082984601 11:59157741-59157763 GGGGCAAAGGGGAAGGAAATTGG - Intergenic
1083266748 11:61550432-61550454 GGGGCCAGAGGGCAGGGGGAGGG + Intronic
1083419606 11:62545718-62545740 AGGGGCAAAGGGGAGGAGGAAGG - Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083913044 11:65721016-65721038 GGGGGGAGGGGGAAGGAGGGGGG - Intergenic
1083964482 11:66035029-66035051 TGGCACAAGGGGAAGGGGGAAGG + Intergenic
1084012544 11:66360682-66360704 GGGTCTACTGGGAAGGAGGATGG + Intronic
1084163792 11:67365644-67365666 AGGGTGATGGGGAAGGAGGAGGG + Intronic
1084164306 11:67367752-67367774 GAGGCAGAGGGGATGGAGGAGGG + Intronic
1084171587 11:67403785-67403807 GGGGCCATGGGGAAGGTGGGAGG + Intronic
1084187603 11:67483140-67483162 GGAGCAGCGGGGAAGGAGGATGG + Exonic
1084216131 11:67647787-67647809 GGGGCCCAGCAGAAGGACGAAGG - Intronic
1084237310 11:67796494-67796516 GGGGCCTTGTGGCAGGAGGAGGG - Intergenic
1084288628 11:68147488-68147510 GGGGCCAGGAGGAAGTTGGAGGG + Intergenic
1084304256 11:68271586-68271608 GGGCCCAAGAGACAGGAGGAGGG - Intronic
1084666769 11:70580588-70580610 GGGCTCAAGATGAAGGAGGAGGG + Intronic
1084769637 11:71334363-71334385 GGGGCCAGTGGGAAGGAGCCAGG - Intergenic
1085273500 11:75283818-75283840 GGGGACCTGGGGAAGGAGCAGGG + Intronic
1085312893 11:75526323-75526345 GGGGTCACGGGGAAGGAGCAGGG + Intergenic
1085319385 11:75564756-75564778 GGGTCCAAGGGGAGGGAGGTGGG - Intronic
1085386877 11:76162668-76162690 GGGGCTGAGGGGAAAGAGGCAGG - Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085502703 11:77038077-77038099 GGGGATGAGGGGGAGGAGGAGGG + Intronic
1085891399 11:80584393-80584415 AGAGGCGAGGGGAAGGAGGAAGG + Intergenic
1085902212 11:80714602-80714624 GGGGCCAATCGGAGGGTGGAGGG + Intergenic
1086074857 11:82839731-82839753 AGGGCAAAGGGGAAGGAGCCTGG - Intronic
1086193427 11:84108174-84108196 GGGGAGCAGGGGAAGGAAGAGGG + Intronic
1086649744 11:89273375-89273397 GGGGCGTGAGGGAAGGAGGATGG + Intronic
1086802639 11:91195921-91195943 GGGTCACAGGGGAAGGAAGAGGG - Intergenic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087499133 11:98929167-98929189 GGGGCACAGGGGGAGGGGGACGG - Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1088197678 11:107293867-107293889 GAGGGCAAGAGGAAGGAGGGCGG + Intergenic
1088339288 11:108745038-108745060 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088339292 11:108745045-108745067 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088339296 11:108745052-108745074 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
1088413061 11:109556869-109556891 CGGGCTTGGGGGAAGGAGGAGGG + Intergenic
1088596027 11:111440881-111440903 GGGGACAAGGAGAGTGAGGAGGG + Intronic
1088998089 11:115021166-115021188 GGGGGCAAGAGGAAGGGGAAGGG - Intergenic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089452973 11:118609988-118610010 GGGGCGAAGGAGAGGGAGGCTGG - Intronic
1090064106 11:123488668-123488690 GTGGCAACGGGGGAGGAGGAGGG - Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1090266101 11:125353893-125353915 GGGGCTAAGGGAAAGGAGCTAGG + Intronic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1091211080 11:133861974-133861996 GGGGCCGAGGGTAGGGAGAATGG - Intergenic
1202816751 11_KI270721v1_random:49680-49702 GGGACCAGGAGGAGGGAGGAAGG - Intergenic
1091375519 12:22523-22545 GGGGAAAGGGGAAAGGAGGAAGG + Intergenic
1091387276 12:103332-103354 GGGGCTCAGGAGAAGGAGGTGGG + Intronic
1091449767 12:565203-565225 GGGACCCAGGTGAGGGAGGATGG - Exonic
1091591479 12:1845390-1845412 GGGGAGGAGGGGAGGGAGGAGGG + Intronic
1091618969 12:2071209-2071231 GGAAGCAAAGGGAAGGAGGAAGG - Intronic
1091642367 12:2247063-2247085 GGAGTCAAAGGGAAGAAGGAAGG - Intronic
1091718191 12:2794741-2794763 GGGTCCCAGGAGAAGGGGGAGGG + Intergenic
1091781541 12:3217198-3217220 GAGGCCCAGGGGCAGGTGGAAGG - Intronic
1091786332 12:3245305-3245327 GGTGCCCAGGGGATGCAGGAAGG + Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1091910461 12:4226666-4226688 GGAGCAAAGAGGAAGGAAGAGGG - Intergenic
1091912728 12:4244931-4244953 GGGGTGATGGGGAAGGAGGAGGG - Intergenic
1092154477 12:6273594-6273616 GGGGAGCAGGGGAAGGAGCAGGG + Intergenic
1092423334 12:8352603-8352625 GGGTTCAGGGGGAAGGGGGAGGG - Intergenic
1093000841 12:13993941-13993963 GGGGGAAGGGGGAGGGAGGAAGG + Intergenic
1093017644 12:14170961-14170983 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1093118969 12:15244914-15244936 GGGGAAAAGGGAAAGGAAGAGGG + Intronic
1093141634 12:15516567-15516589 GAGGGCAGGGGGAGGGAGGAAGG + Intronic
1093151653 12:15628078-15628100 GGGGAAAAGGGGAGGGAGGGAGG + Intronic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1094085555 12:26587585-26587607 GAGGACAAGGGGAAGAAGGGTGG + Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094250432 12:28353883-28353905 GGGGCCAATTGGAAGGTGGAGGG + Intronic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1094778242 12:33757831-33757853 GAGCCCAAGGGGAAAGAGGAGGG - Intergenic
1095168081 12:38998380-38998402 GGGGAGAAAGGGAAGGGGGAGGG - Intergenic
1095457275 12:42401501-42401523 GTGGCCATGGGGAGGGGGGAGGG + Intronic
1095647766 12:44569035-44569057 GGGGCCTATTGGAAGGTGGAAGG - Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096046828 12:48569810-48569832 GGGGCGAAGTGGAAGAAAGAGGG + Intronic
1096156607 12:49344981-49345003 GGGGCCAGGCGGAGGGAGGTTGG - Intergenic
1096490024 12:52008027-52008049 GGGGCCGGGGCGAAGGAGGGCGG - Intronic
1096504116 12:52082023-52082045 AGGGCCCCGGGGAAGCAGGATGG - Intergenic
1096527145 12:52217225-52217247 GGAGCCTAGGGAAGGGAGGAGGG - Intergenic
1096619021 12:52850886-52850908 TGGGGCCAGGGGAAGGAGGAAGG - Intergenic
1096788633 12:54031788-54031810 GGGGCTACGGGGGAAGAGGATGG + Intronic
1096803688 12:54127570-54127592 GGGGCCCAGGACAAGGGGGAAGG + Intergenic
1097092521 12:56518524-56518546 GTGTCCAAGGTGAAGGAGTAGGG - Intergenic
1097167525 12:57093670-57093692 GGGGCCAGGTGGGAGGAAGAGGG + Intronic
1097245865 12:57607280-57607302 GGGGCAGGGGGGGAGGAGGAGGG - Exonic
1097270418 12:57770723-57770745 GGGGCAAAGGGGAGGGGAGATGG + Intronic
1097694683 12:62764823-62764845 GGGGCCATGGAGAAGGATGGAGG + Intronic
1097818733 12:64105058-64105080 GGGGCGGAGGTGCAGGAGGATGG - Intronic
1097924238 12:65110250-65110272 GGGGGCCAGGGGAAGGGGGCAGG - Intronic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098393880 12:69997814-69997836 GGGGCAGAGGGAAAGGGGGAAGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098599838 12:72317881-72317903 GGGCTGAAGGGGCAGGAGGAAGG + Intronic
1099385305 12:82006243-82006265 GGGGAAGGGGGGAAGGAGGAAGG + Intergenic
1100159507 12:91842217-91842239 GGGGCCAATTGAAGGGAGGAGGG + Intergenic
1100184793 12:92127646-92127668 GGGGAGAAGAGGAGGGAGGATGG + Intronic
1100258403 12:92907532-92907554 GTGGCCAAGGAGATGGAGAAAGG - Intronic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1100715653 12:97302505-97302527 GGGGTAAGGGGGTAGGAGGATGG + Intergenic
1100811400 12:98342389-98342411 GGGGCTCTGCGGAAGGAGGAAGG - Intergenic
1101304546 12:103514505-103514527 GGCCCCATGGGGAAGGAGTATGG + Intergenic
1101492105 12:105219103-105219125 GAGGCCAAGGCCAAGGAGGTAGG - Intronic
1101779744 12:107824595-107824617 GGGGCCAAGAGGAAGCAGAATGG + Intergenic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102241471 12:111327084-111327106 GGAGCTGGGGGGAAGGAGGATGG - Intronic
1102397054 12:112595501-112595523 AGGCAAAAGGGGAAGGAGGAGGG - Intronic
1102408789 12:112698898-112698920 GGGGAGGAGGGGGAGGAGGAAGG - Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102687621 12:114736610-114736632 GGGGGCGCGGGGGAGGAGGAGGG - Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103156216 12:118687185-118687207 GGGGCGATGGGGTGGGAGGAGGG - Intergenic
1103270331 12:119668209-119668231 GGGGACACAGGGAAGGCGGACGG - Exonic
1103321324 12:120094185-120094207 GGGGCCTGGGTGGAGGAGGAGGG - Exonic
1103478020 12:121232788-121232810 GGGGCCAAGGGAAAGAAGGTAGG - Intronic
1103501565 12:121407066-121407088 GGGGGGAGGGGGAAGGAGGGAGG - Intronic
1103520695 12:121535821-121535843 GGGGCAGAGCTGAAGGAGGAGGG + Intronic
1103674759 12:122646953-122646975 GGCACCACGGGGAAGGGGGAGGG - Intergenic
1103701203 12:122849531-122849553 GGGGCCGTGGGGCTGGAGGAGGG + Intronic
1103909948 12:124346658-124346680 GTGGCCACGGTGAAGGAGGCGGG - Exonic
1103929347 12:124440973-124440995 GGGGCAGAGAGGACGGAGGAGGG + Intronic
1103968588 12:124655577-124655599 GAAGCCAAGGGGAAGGGTGACGG - Intergenic
1104218550 12:126759364-126759386 TGGGCCAGGAGGAAGAAGGAAGG - Intergenic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104301745 12:127570686-127570708 GGAGGAAAGGAGAAGGAGGAAGG + Intergenic
1104800770 12:131554079-131554101 GGGTCCAGGGGGAAGGCAGAAGG + Intergenic
1104955963 12:132465966-132465988 GGAGCCAAGGAGAGGGAGGTCGG + Intergenic
1105255215 13:18739741-18739763 AGGGCCAAGGGGAACCAGGGGGG - Intergenic
1105859416 13:24395598-24395620 TGGGGCAGGGGGCAGGAGGAAGG - Intergenic
1106073167 13:26433651-26433673 AGGGCCAGGGGGTGGGAGGAGGG + Intergenic
1106135034 13:26967551-26967573 TGGGATAGGGGGAAGGAGGAGGG + Intergenic
1106190320 13:27446837-27446859 GGGGCGGATGGGAAGGAGGCTGG + Intronic
1106720746 13:32432362-32432384 GGGGCTGAGGGGAAGGGGGAAGG + Intergenic
1106720752 13:32432376-32432398 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1106995886 13:35478901-35478923 GGGTCCAACGGGAAGGACGCGGG + Intronic
1107126890 13:36856039-36856061 GGTGCCAGGGGGCAGAAGGATGG + Intronic
1107420124 13:40238354-40238376 AGCCCCAAGTGGAAGGAGGATGG - Intergenic
1107471834 13:40698263-40698285 GGGGCAAATGGGAAGGAATATGG - Intergenic
1107598184 13:41985594-41985616 GGGACCAAGGGCTTGGAGGATGG - Intergenic
1107718057 13:43220064-43220086 GGGGCAAAGGGAGGGGAGGAAGG + Intronic
1107742317 13:43464423-43464445 GGGGACCTGGGGAAGGAGGGAGG + Intronic
1107761940 13:43688748-43688770 GGGGCACAGGAGAAGGAGCAGGG + Intronic
1107813318 13:44220565-44220587 GAGGCCGAGGGACAGGAGGAGGG - Intergenic
1107842614 13:44474737-44474759 GGGAGGTAGGGGAAGGAGGACGG + Intronic
1107999447 13:45892768-45892790 GGGGAGTAGGGGAGGGAGGAGGG + Intergenic
1108687724 13:52835284-52835306 GGGGGGAAGGGGGAGGAGGTAGG + Intergenic
1108800915 13:54093167-54093189 AGGCCCAAGGGGAAGGTGGTCGG + Intergenic
1109058349 13:57581411-57581433 GGGGCAAATGGGAAGGAGTAAGG - Intergenic
1109166265 13:59039319-59039341 GGGGCCAAGGTCAAGGTAGAAGG - Intergenic
1109181585 13:59220086-59220108 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1109497897 13:63197937-63197959 GGGGTCGGGGGGAAGGGGGAGGG + Intergenic
1110033980 13:70655104-70655126 AGGGCAAAGGGGAAGCAGGCAGG - Intergenic
1110034778 13:70669347-70669369 TGAGACAAGGGGAAGGAGGAAGG - Intergenic
1110047304 13:70846251-70846273 GGGAACAGGGGGAAGCAGGAGGG - Intergenic
1110119545 13:71865610-71865632 GGGGACGAGAGGGAGGAGGACGG - Intronic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110427232 13:75382135-75382157 AGAGCCAAGGGGAAGGAGAGAGG - Intronic
1111446066 13:88347650-88347672 GGGGAAAAAGGGAGGGAGGAAGG + Intergenic
1111446077 13:88347692-88347714 GGGGAAAAAGGGAGGGAGGAAGG + Intergenic
1111967979 13:94880420-94880442 GGAGCAAAGGGGAAGGCTGAGGG - Intergenic
1111996919 13:95174660-95174682 GTCGCCGCGGGGAAGGAGGAAGG - Intronic
1112061905 13:95749413-95749435 TGGGCCAAAGGGAAAGAGGAAGG + Intronic
1112207302 13:97337429-97337451 TGGGCAAAGGAGACGGAGGAAGG - Intronic
1112414373 13:99192109-99192131 GGGGTAGAGGGGAAGGAGAAGGG + Intergenic
1112794413 13:103039757-103039779 AGGGCCAGTGGGAAGGAAGAAGG + Intergenic
1113025859 13:105939986-105940008 GGGGCCTAGTGGGAGGTGGATGG + Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113150747 13:107261192-107261214 GGTTCCCAGGGGAAGGAGGCAGG + Intronic
1113375934 13:109765668-109765690 GGAGCCAAGGTGGAGGAGGCTGG - Intronic
1113439261 13:110314982-110315004 GGGGCCAAGGGAAAGGGGCCTGG + Intronic
1113585255 13:111460199-111460221 GGGGAAAGGGGCAAGGAGGAGGG + Intergenic
1113899355 13:113788055-113788077 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899369 13:113788086-113788108 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899383 13:113788117-113788139 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899397 13:113788148-113788170 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899411 13:113788179-113788201 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899425 13:113788210-113788232 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899439 13:113788241-113788263 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899453 13:113788272-113788294 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899467 13:113788303-113788325 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899481 13:113788334-113788356 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113899495 13:113788365-113788387 TGGGCAGAGGGGAAGGCGGAGGG + Intronic
1113992009 14:16035383-16035405 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
1114260113 14:21030517-21030539 GGGGTGAAGGAGAAGGGGGAGGG - Exonic
1114532122 14:23402825-23402847 GGGGCAAGGGGGCAGGCGGAGGG + Intronic
1114604949 14:23988873-23988895 AGGGCGAAGGGGCAGGACGAAGG - Exonic
1114610398 14:24036427-24036449 AGGGCGAAGGGGCAGGACGAAGG - Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114660022 14:24338132-24338154 GGGGGCACGAGGAGGGAGGAGGG + Intronic
1114956899 14:27832828-27832850 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1114972865 14:28056132-28056154 TGGGCTGAGGGGAGGGAGGAGGG - Intergenic
1115269154 14:31532436-31532458 GGGGGAAAGGGGAAGTGGGAAGG - Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1115661072 14:35494686-35494708 GGGGAAAAGGGGAGGGAAGAGGG + Intergenic
1115754770 14:36519830-36519852 GGAGGGGAGGGGAAGGAGGAGGG + Intronic
1115906209 14:38206098-38206120 GGGGCAGAGGGGAAAGAGGAAGG - Intergenic
1115952785 14:38739935-38739957 GGAGCCAAGGGGAGGAGGGAGGG + Intergenic
1116078531 14:40143837-40143859 TGGGGCAGGGGGAAGGGGGAGGG + Intergenic
1116360644 14:43992172-43992194 GGGACCTATGGGAAGGTGGAGGG + Intergenic
1116707973 14:48327719-48327741 GGGGGTAAGGGGAGGGGGGAGGG - Intergenic
1116794520 14:49375598-49375620 GGGGCAGGGGGAAAGGAGGAAGG + Intergenic
1116916853 14:50532985-50533007 GGGGCGCCGGGGAAGGAGGTGGG + Intronic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1117073207 14:52074828-52074850 GGGGCCAGGGAGAAGGAGGTTGG - Intergenic
1117079072 14:52132817-52132839 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1117149768 14:52873500-52873522 GGGTCAAGGGGGAAGGAGAAAGG + Intronic
1117368312 14:55052216-55052238 GGGGCCAAGGGGCGCGAGGCCGG - Intronic
1117372772 14:55093991-55094013 GAGGACGAGGGGGAGGAGGAGGG + Intergenic
1117438729 14:55741369-55741391 GAGGCCTGGGGGAAGGAGGAGGG + Intergenic
1117790106 14:59331367-59331389 GAGGCCCTGGGGGAGGAGGAGGG - Exonic
1117841453 14:59864524-59864546 GGGGGCAAGGGGAGAGAGTAAGG - Intronic
1118033374 14:61839885-61839907 GGGGAAAGGGGGAGGGAGGAGGG + Intergenic
1118319859 14:64746727-64746749 GGGACAAAGGGGAAGGAGAGAGG + Exonic
1118732610 14:68678982-68679004 GGGGGCAGGGGCAGGGAGGAGGG - Intronic
1118796942 14:69152669-69152691 GGGGACAGAGGGCAGGAGGAGGG + Intronic
1119136859 14:72229262-72229284 GGGGCCAAGGGGTGAGGGGAGGG - Intronic
1119722647 14:76901557-76901579 GGGGCCAGGAGGAGGCAGGAGGG + Intergenic
1119789429 14:77336633-77336655 GGGGGCAAAGGGTAGGAGTATGG - Exonic
1119966941 14:78927355-78927377 GGGAACAAGCGTAAGGAGGAGGG + Intronic
1120794905 14:88622027-88622049 GCGGACAAGGGGGAGGGGGAGGG - Exonic
1121340223 14:93100516-93100538 GGGGCCGGGGGGAGAGAGGAGGG + Intronic
1121444906 14:93972735-93972757 GGGGTCAAGGGCAAGGTGGCTGG - Intronic
1121652076 14:95566117-95566139 AGAGGAAAGGGGAAGGAGGAAGG + Intergenic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1121863377 14:97339956-97339978 TGAGCCAAGGGAAAGGAGAAGGG - Intergenic
1121955646 14:98210294-98210316 GGGCTCCAGGGGGAGGAGGAAGG + Intergenic
1122070592 14:99203174-99203196 GCGGCCATGGGGAACGAGAACGG - Intronic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122228285 14:100292252-100292274 GGAGCCCTGGGGAAGGAGGGCGG + Exonic
1122229411 14:100298193-100298215 GGGGCCAAGGAAAAAGAGCAAGG + Intronic
1122384195 14:101332896-101332918 GGGGACAAGGGGAAGAGGGAGGG + Intergenic
1122453173 14:101828230-101828252 GGGGCTGCGGGGAGGGAGGAAGG + Intronic
1122461010 14:101895473-101895495 GGGGCCAGAGGGAGGGAGAACGG - Intronic
1122620760 14:103056707-103056729 GGCTCCAAGGGGCAGGATGAGGG + Intronic
1122727971 14:103771972-103771994 GGGGCAAAGAGATAGGAGGAAGG - Intronic
1122847239 14:104506615-104506637 TGGGGCAGGGGGCAGGAGGAAGG - Intronic
1122895526 14:104754791-104754813 GGGGCCAGGAGGAAGGTGCAGGG + Intronic
1122977255 14:105175935-105175957 GAGGTCTTGGGGAAGGAGGAGGG - Intronic
1123005929 14:105323833-105323855 GGGGCCAAGGGGCAGCAGGACGG + Intronic
1123062751 14:105601691-105601713 CGGGTCAAGGGGAAGACGGATGG + Intergenic
1124061152 15:26294734-26294756 GGGTCCACAGGGAAGGAGAAAGG - Intergenic
1124092220 15:26616180-26616202 GGGGCCAAGGAGAGGATGGAGGG + Intronic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1124620765 15:31272690-31272712 GGTGTCAAGGGCAAGGAGGTGGG - Intergenic
1124746074 15:32343031-32343053 GGGGCGACGGGGACGGAGGCGGG - Intergenic
1124885006 15:33677215-33677237 GGGGCCATGGGGATGGAGAGAGG + Intronic
1124993588 15:34700371-34700393 GGGGAGAAGGGAGAGGAGGAGGG - Intergenic
1125004321 15:34800139-34800161 GGAGGGCAGGGGAAGGAGGAAGG + Intergenic
1125220577 15:37328443-37328465 AGGGGCTTGGGGAAGGAGGAGGG + Intergenic
1125766455 15:42139791-42139813 GGGGGCAGGGGGCAGGAGGCTGG - Exonic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126296673 15:47145825-47145847 GGGGCCTTGTGGAAGGAGTATGG - Intergenic
1126932644 15:53671966-53671988 GGGGAGAAGGGGAAAGAGGGAGG + Intronic
1127136900 15:55933535-55933557 GGGGGGAGGGGGAAGGGGGAGGG + Intronic
1127646171 15:60961628-60961650 TGGGCCAAAGGAAAGGAGGAGGG + Intronic
1127980768 15:64033271-64033293 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128539645 15:68517703-68517725 AGGGCCCAGGGAGAGGAGGATGG + Intergenic
1128720447 15:69943763-69943785 GAGGGCCAGGGGAAGGAGGCTGG + Intergenic
1128776977 15:70328133-70328155 GGGGTCGAGGAGAAGGAGGGGGG - Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128887939 15:71305432-71305454 GGGGCCCATTGGAGGGAGGATGG + Intronic
1129044885 15:72725780-72725802 GGGGGAAGAGGGAAGGAGGAAGG - Intronic
1129044950 15:72725913-72725935 GGGGAAAGGGGGAAGGGGGATGG - Intronic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129155045 15:73712482-73712504 GAAGCCCAAGGGAAGGAGGAGGG + Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129661391 15:77554847-77554869 GGGGCAGTGGGGAGGGAGGAGGG + Intergenic
1129661814 15:77556969-77556991 GGAGCCCAGGAGAGGGAGGAAGG + Intergenic
1129664517 15:77572079-77572101 GGGTCAAAGGGCAAGGAGAATGG + Intergenic
1129756702 15:78103222-78103244 GGAGAGAAGGGGAAGAAGGAGGG - Intronic
1130042133 15:80413821-80413843 GGGGCCAAAGGAGAGGAGGGTGG + Intronic
1130189463 15:81719106-81719128 GGGGCCTACTGGAAGGTGGAGGG - Intergenic
1130273946 15:82466812-82466834 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130284441 15:82543140-82543162 GGGGCTAACGGGAGGGAGTAAGG - Intronic
1130466294 15:84194186-84194208 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130497970 15:84479350-84479372 GGGGCCCTGCAGAAGGAGGATGG - Intergenic
1130588588 15:85198779-85198801 GGGGCCCTGCAGAAGGAGGATGG + Intergenic
1130666228 15:85872175-85872197 GGAGCCAAGGGCAAGGTGGGAGG - Intergenic
1130843323 15:87722382-87722404 GGGGAGCAGGGGAAGGAGGGAGG - Intergenic
1130906341 15:88243181-88243203 GGGGGCAAGGGCGTGGAGGAGGG - Intronic
1130959877 15:88652508-88652530 GGGGAGGAGGGGAAGGAGGAGGG - Intronic
1131117396 15:89803607-89803629 TGGGGCACGGGGAAGGAGGTGGG - Intronic
1131340022 15:91590323-91590345 GGTGGCCAGGGAAAGGAGGAAGG + Intergenic
1131460979 15:92617350-92617372 GGGCCCAAGGCTGAGGAGGAGGG - Intergenic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131649870 15:94387122-94387144 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132251027 15:100335428-100335450 GGGGCTCTGGGGAGGGAGGAGGG - Intronic
1132399306 15:101495758-101495780 GGGGGGAAGGGAAGGGAGGAGGG + Intronic
1132583169 16:694495-694517 GGGTCCGAGGCGGAGGAGGAGGG - Intronic
1132606235 16:794918-794940 GGGCCCAAGGGGTCGGGGGAGGG - Intronic
1132689087 16:1174505-1174527 GTGGCCATGGGGAGGGAGGGAGG + Intronic
1133101504 16:3482800-3482822 GGGGGCATGTGGAAAGAGGATGG - Intronic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133605645 16:7385252-7385274 GGGGCCCAGGAGAAGAAGGCAGG + Intronic
1133749499 16:8713563-8713585 GGAGGGAAGGTGAAGGAGGAGGG - Exonic
1134066595 16:11232462-11232484 AGGGGCAGGGGGGAGGAGGAGGG + Intergenic
1134236153 16:12468060-12468082 GGGGACAAGTGAAAGGAGGCTGG - Intronic
1134257890 16:12626578-12626600 AGGGCCAGGGGGAAGCTGGATGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134692152 16:16197942-16197964 GGTGGGAGGGGGAAGGAGGAGGG + Intronic
1134805254 16:17118783-17118805 GGGGTCATGGAGATGGAGGATGG - Intronic
1134839845 16:17393030-17393052 GGGCAGGAGGGGAAGGAGGAAGG - Intronic
1135050022 16:19185165-19185187 GGGGAGGAGGGGAGGGAGGAAGG - Intronic
1135480704 16:22818620-22818642 GGGGAGAGAGGGAAGGAGGAAGG - Intronic
1135690452 16:24533084-24533106 GAGGCCAAGGGGTGGGGGGAGGG + Intergenic
1135795854 16:25441872-25441894 GGGACCGAGGGGAAGGAGTAGGG + Intergenic
1136187763 16:28598041-28598063 GGGGCACAGAGGAGGGAGGAGGG - Intergenic
1136246524 16:28979319-28979341 GGGGCCTGGGGGAAGGCAGAAGG + Intronic
1136251564 16:29008908-29008930 GGGGCGAGGGGGAGGGAGGCAGG - Intergenic
1136483798 16:30558275-30558297 CGGGCCCAAGGGAAGGAGGGAGG + Exonic
1136566919 16:31076234-31076256 GGGGCCAAGGCCTAGGAAGAGGG - Exonic
1136616116 16:31399552-31399574 GGGGACCAAGGGAAGGGGGAAGG + Intronic
1136998028 16:35204153-35204175 GGGGCCAAAGGGAAGGTAAAGGG + Intergenic
1137249778 16:46732960-46732982 TGGGCCCAGGGGAAGGTAGAGGG - Intronic
1137351260 16:47715977-47715999 GGGGCCAAGCCAAAGGAAGAAGG - Intergenic
1137384580 16:48029775-48029797 GAGGCACGGGGGAAGGAGGAGGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557056 16:49477296-49477318 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557066 16:49477317-49477339 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557081 16:49477347-49477369 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557091 16:49477368-49477390 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137610064 16:49811984-49812006 CAGGCCTAGGGGCAGGAGGAAGG - Intronic
1137774069 16:51041038-51041060 GGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1137975170 16:53025124-53025146 GAGGCCAAGGCCAAGGTGGAAGG + Intergenic
1138108531 16:54305124-54305146 AGGGCGAAGGGGAAGGGGCAGGG - Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139108659 16:63861817-63861839 GTGGCCAAAGGAGAGGAGGAAGG + Intergenic
1139424925 16:66873702-66873724 GGGGAGGAGGGGGAGGAGGAGGG - Intergenic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139603999 16:68004972-68004994 GGGGCCAAGGTTAAAGTGGATGG - Intronic
1139963622 16:70732471-70732493 GGGGACAAGGGAAAGGCTGATGG + Intronic
1140008691 16:71108157-71108179 GGGGCCTAGTGGAGGGCGGAGGG + Intronic
1140279635 16:73543028-73543050 GGGGACCACGGGAAGGAGAAGGG + Intergenic
1140411492 16:74743629-74743651 GGGACAAAGGGGAAGGGGGTCGG + Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1141497409 16:84419634-84419656 GGCCCCAAGGGAAGGGAGGAGGG - Intronic
1141527101 16:84618430-84618452 GGGAAGAAGAGGAAGGAGGAGGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1142137801 16:88459677-88459699 GGGGAGGAGGGGGAGGAGGAAGG - Intronic
1142137811 16:88459698-88459720 GGGGAAGAGGGGAAGGGGGAAGG - Intronic
1142177018 16:88650133-88650155 GGGGCTGAGGGTGAGGAGGAGGG - Intronic
1203141917 16_KI270728v1_random:1772303-1772325 GGCTGCAAGGGGGAGGAGGAGGG - Intergenic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1142897543 17:2991636-2991658 TGGGCCAAAGGTAAGTAGGAAGG - Intronic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143476201 17:7205132-7205154 GGGGCGTAGGGGAGCGAGGAAGG - Intronic
1143491934 17:7289895-7289917 TGGGGCAAGGGACAGGAGGATGG - Intronic
1143645005 17:8224239-8224261 GGGCCCAAGGGGAGGGAGACAGG - Intergenic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1144143670 17:12376363-12376385 GGGGTGAAGGGGGAGGAGGGAGG + Intergenic
1144229791 17:13190426-13190448 GGGTCCAAGGAGGAGGAGAAAGG + Intergenic
1144273535 17:13643179-13643201 GGGGTTAAGGTGAAGGGGGAGGG - Intergenic
1144513936 17:15902028-15902050 GGGGCTGAGGGGAGGGAGAATGG - Intergenic
1144702980 17:17350848-17350870 AGGGCCAAGGGGGAGCAGCATGG - Intergenic
1144711441 17:17404081-17404103 GGGGCCTAGGGGAAGGAGGTGGG + Intergenic
1144948133 17:18980263-18980285 CTGGCCATGGGGAAGGAGAAAGG - Intronic
1145232116 17:21180684-21180706 GGAGGCAAGGGGGAGGAGGAGGG + Intronic
1145390721 17:22453779-22453801 GGGGCCAAGGCGAGGGGAGAAGG - Intergenic
1145415108 17:22708346-22708368 GGGCCCAAAGGGAAGGAGAGAGG + Intergenic
1145984720 17:29037749-29037771 GGGGGCAAAGGGAGGGAGGATGG + Intronic
1145994450 17:29097403-29097425 GGGGCAGAGGGGAAGGAGGATGG + Intronic
1146260784 17:31418952-31418974 GGTGCCAAGAGCGAGGAGGAGGG - Intronic
1146529100 17:33592690-33592712 CGGACCAAAGTGAAGGAGGAGGG + Intronic
1146984668 17:37203834-37203856 CTGGCCAAGGGCAAGAAGGAAGG + Intronic
1147134261 17:38426062-38426084 GAGGCCATGGGGGAGGAGGGAGG - Intergenic
1147136169 17:38435284-38435306 GATGCCAAGTGGGAGGAGGAAGG + Intronic
1147139217 17:38452166-38452188 GGAGCCTAGGGGACGGAGGTGGG - Intronic
1147363592 17:39946154-39946176 AGGGGCAAGGGGAAGGTGGGTGG + Intergenic
1147456654 17:40542226-40542248 GATGCCAAGAGGACGGAGGAGGG - Intergenic
1147462206 17:40580457-40580479 GGGGCCCAGGTGCAGGGGGAAGG + Intergenic
1147615567 17:41825375-41825397 GGTGCTCAGGGAAAGGAGGACGG + Intronic
1147723020 17:42550258-42550280 GGGCACTAGGGGAAGGAGGCAGG + Exonic
1147792003 17:43019869-43019891 GGGTCCATGGGGAAGGGGGATGG + Intronic
1147954300 17:44123713-44123735 GCGGGCAAGGGGAAGGCGGGGGG - Intergenic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1148105305 17:45115496-45115518 GGGGCCAACGTGGAGGATGAAGG + Intronic
1148147297 17:45373896-45373918 GGGGCCAGGGAGAAGGGAGAAGG - Intergenic
1148245917 17:46030778-46030800 GGTACCAAGGGGCATGAGGAGGG + Exonic
1148462307 17:47845809-47845831 GGGAGCGAGGGGAAGGGGGAGGG + Exonic
1148495116 17:48048718-48048740 GGGGCCATCGGGACGGAGGGCGG + Intronic
1148552305 17:48557695-48557717 GGGGACATGGGGATGGAGGGTGG + Intronic
1148564497 17:48625259-48625281 CCGGCCAAGGGGAAGGGGGAGGG - Intronic
1148597116 17:48865568-48865590 GGTGCGAGGGGGATGGAGGAAGG - Intronic
1148605829 17:48928221-48928243 GGGGGCACGGGGGAGGCGGAAGG - Exonic
1148782175 17:50128665-50128687 GGGACCCAGGAGAAGGAGAAAGG + Intronic
1148785887 17:50146025-50146047 GGGGCCCAGGAGACTGAGGAGGG + Intronic
1148835059 17:50461564-50461586 GGGGCGGAGGGGCAGCAGGAGGG + Intronic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149646505 17:58245284-58245306 GGGGTTAAGCTGAAGGAGGAGGG + Intronic
1149812784 17:59693677-59693699 GGGGGCAGGGGCAAGGAGGCAGG - Intronic
1149946331 17:60931672-60931694 GGTGACAAGGTGAAGGAGGAAGG - Intronic
1149995816 17:61405465-61405487 GCGGCCGAGGGCAAGGAGCAGGG + Exonic
1150118919 17:62582794-62582816 GGTTCCAAGGACAAGGAGGAGGG - Intronic
1150134816 17:62689861-62689883 GGGGCCATGGGGTGGGAGGAAGG - Intronic
1150244581 17:63664814-63664836 GGGAAAAAGAGGAAGGAGGAAGG - Intronic
1150321861 17:64221201-64221223 GGGGGCAGGGGGCAGGAAGAGGG + Intronic
1150407674 17:64916679-64916701 GAGGCCAAGAGGTGGGAGGATGG + Intronic
1150439401 17:65179163-65179185 GGTGTGCAGGGGAAGGAGGAGGG + Intronic
1150689589 17:67353298-67353320 GGGAGCGGGGGGAAGGAGGAAGG - Intronic
1151154312 17:72114138-72114160 GGGGCCAAGAGGAAAGAGATGGG + Intergenic
1151176243 17:72290534-72290556 GCAGCCAAGGGGAAGGAAGAGGG + Intergenic
1151296808 17:73192336-73192358 GTGGCCATGGGGGAGGAGGGCGG - Intergenic
1151422811 17:74009655-74009677 GGGGCCCGGAGGAAGGAGGAGGG + Intergenic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151542211 17:74770340-74770362 GGGGCCAAAGGGTAGAAGCAAGG - Intergenic
1151598473 17:75091849-75091871 GGGGCCAGGGCGCAGGAGGCAGG + Intronic
1151666703 17:75549454-75549476 GGGCCTAAGGGGACAGAGGAGGG - Intronic
1151874914 17:76862320-76862342 GGGGCCTATGTGGAGGAGGAGGG + Intergenic
1151956505 17:77382822-77382844 GAGGCAAAGGCGAGGGAGGAGGG + Intronic
1152022167 17:77785785-77785807 GGTGTCAAGGGGAGGGAAGAAGG + Intergenic
1152201091 17:78946747-78946769 GGGCAGAAGAGGAAGGAGGAAGG - Intergenic
1152205533 17:78972569-78972591 GGGGTCCTGGGGGAGGAGGATGG + Exonic
1152329005 17:79659823-79659845 GGGGGGAAGGGGAGGGAAGAGGG - Intergenic
1152486163 17:80595015-80595037 GGGGCTAAGGGGAACAAGAAGGG + Intronic
1152524312 17:80878958-80878980 CGGGGCCTGGGGAAGGAGGAGGG - Intronic
1152525280 17:80884835-80884857 GTGGCAACGGGGAAGGAGGTGGG - Intronic
1152609199 17:81307399-81307421 GGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1152742778 17:82025615-82025637 AGAGCCCAGGGGAAGCAGGAAGG + Intronic
1152750537 17:82060565-82060587 CTGCCCAAGGGAAAGGAGGAGGG - Intronic
1152779595 17:82220320-82220342 GGGGCCAAGGGGCTGGGGTAGGG + Intergenic
1152811970 17:82386520-82386542 GCTGCCCAGGGGAAGGCGGAGGG - Intergenic
1153729213 18:7990826-7990848 GGGGCCTGGGGGACGGGGGATGG + Intronic
1154322901 18:13368879-13368901 AGGGCCATGGGGAAGGTGGCAGG + Intronic
1154346655 18:13548466-13548488 GGGGCCAAGGGCAAGGGGCTGGG + Intronic
1154371274 18:13765357-13765379 GGGCTCAAGGGGAAGGAAGCTGG + Intergenic
1154435806 18:14340861-14340883 AGGGCCAAGGGGAACCAGGGGGG + Intergenic
1155174788 18:23292498-23292520 GGTGGCAAAGGGAAGGAGCATGG + Intronic
1156270168 18:35523461-35523483 GAGGCCAAGGGGCGGGAGGGCGG - Intergenic
1156460299 18:37317998-37318020 TTGGCCAGGGGGCAGGAGGAAGG - Intronic
1156486784 18:37471490-37471512 AGGGGCAAAGGCAAGGAGGAGGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156738353 18:40292256-40292278 GGGGGGATGGGGAGGGAGGAAGG - Intergenic
1156839822 18:41598285-41598307 GGCGCTGAGGGGAAGGAGAATGG - Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157391864 18:47309830-47309852 GGGGCCAGGAGGAGGCAGGATGG - Intergenic
1157405495 18:47419277-47419299 GGAGATAGGGGGAAGGAGGAGGG + Intergenic
1157442845 18:47723518-47723540 GGCGCCATGGAGAAGGAGGATGG - Intergenic
1157573473 18:48729091-48729113 GGGGCCATGGGCAGGAAGGATGG - Intronic
1158245159 18:55423980-55424002 GGGGCCATGGGGATGGCAGAAGG - Intronic
1158434853 18:57428421-57428443 GGGAGCAAAAGGAAGGAGGAGGG + Intergenic
1158528186 18:58234282-58234304 GGGAGGAAGGGGAAGGAGAAGGG - Intronic
1159235977 18:65673252-65673274 GGGGCCTAGTTGAAGGTGGAGGG + Intergenic
1159850978 18:73527012-73527034 GGGGGAGAGGGAAAGGAGGAGGG - Intergenic
1159890017 18:73944136-73944158 GGAGCCGTGGGGAAGGAGGTGGG - Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160392679 18:78546968-78546990 GGGAGGAAGGGGGAGGAGGAGGG + Intergenic
1160394739 18:78563450-78563472 GGGGCCCGGGGGAAGCAGCACGG - Intergenic
1160475111 18:79177164-79177186 GGGGGCAAGGACAGGGAGGAAGG - Intronic
1160589293 18:79933724-79933746 GGCGGGAAGGGGAAGCAGGAGGG - Intronic
1160676594 19:394455-394477 GGAGAGATGGGGAAGGAGGATGG + Intergenic
1160766930 19:812877-812899 GGGGCCAAGGCGGAGGCCGACGG - Exonic
1160865243 19:1253282-1253304 GGGCCCATGGGGAGGGAGGCAGG - Intronic
1160872083 19:1282227-1282249 GGTGTGAAGGGGAAGGAGGGAGG + Intergenic
1160967304 19:1752402-1752424 GAGGCAACGGGGAAGCAGGAAGG + Exonic
1161039641 19:2103414-2103436 GGGGCCCAGTGGCAGGAGGGCGG - Intronic
1161207136 19:3047099-3047121 GGGGGAGAGGGGAAGGAGGAGGG - Intronic
1161335249 19:3709441-3709463 GGGGCAGAGGGGAAGGAGGAAGG + Intronic
1161400577 19:4065148-4065170 GGCGTCAAGGGAAAGGAGGGGGG + Intronic
1161400832 19:4065757-4065779 GGGGCCGAGGGGAGGGGGGCTGG + Intronic
1161415676 19:4145274-4145296 GGGGAGGAGGGAAAGGAGGAGGG + Intergenic
1161638677 19:5405852-5405874 GGGGCCAGGCTGAAGGAAGAAGG + Intergenic
1161656952 19:5522246-5522268 GGTGGCAGGGGGAAGGAGAAAGG + Intergenic
1161711530 19:5851294-5851316 GGGGCCGAGGGGAGGAGGGACGG + Intronic
1161734117 19:5979913-5979935 GGGAACAAGGGGAGGGAGGGAGG - Intergenic
1162020165 19:7864673-7864695 GGGGCCGGGGGAAGGGAGGAAGG - Intronic
1162077175 19:8195636-8195658 GGGACCCAGGGAAGGGAGGAGGG - Intronic
1162127640 19:8507933-8507955 GGGGGCAAGGAGAAGGTGGGAGG + Intergenic
1162128939 19:8513694-8513716 GGGGCCAAGGCTACGGAGGCGGG + Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162254912 19:9482440-9482462 GGGGGGAAGGGGGAGAAGGAAGG + Intronic
1162469647 19:10864794-10864816 GGGGCCAAGGGAGAAGAGGGAGG + Intronic
1162580825 19:11529212-11529234 TGGGCCAATAGGAAGGCGGAAGG + Intergenic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162955066 19:14092856-14092878 GGGGCTGTGGGGAAAGAGGAAGG + Exonic
1163023588 19:14496422-14496444 GCGGCCAATGGGAAGGAAGCTGG + Intergenic
1163029816 19:14536980-14537002 GGGGCCGAGGAGGAGGAGGTGGG + Intronic
1163029884 19:14537184-14537206 GAGGCCGAGGGGGAGGAGGTGGG + Intronic
1163073946 19:14871481-14871503 GGGGCCAACTGGAGGGTGGAGGG + Intergenic
1163093146 19:15035393-15035415 GAGGCCAATGGGAAGGGTGATGG - Intergenic
1163179898 19:15591955-15591977 AGGGCCAAGGGGAACCATGAGGG + Intergenic
1163741129 19:19013573-19013595 AGGCACAAGGGGAAGGAGGGAGG - Intronic
1163821181 19:19497502-19497524 GGCTCTGAGGGGAAGGAGGAGGG + Intronic
1163827829 19:19533498-19533520 GGGGCGGAAGGGGAGGAGGAGGG - Intronic
1164208492 19:23077172-23077194 GGGGTCTATTGGAAGGAGGAGGG + Intronic
1164441829 19:28284896-28284918 GGGGTGGAGGGGAAGGAGGGTGG + Intergenic
1164498669 19:28793547-28793569 GGGGCCGCGGAGGAGGAGGAAGG - Intergenic
1164648256 19:29874220-29874242 GGGGCGAGGGGGGAGGGGGAGGG + Intergenic
1164731026 19:30504507-30504529 GGGGGCAGGAGGAGGGAGGAAGG - Intronic
1164956668 19:32392362-32392384 GGGAGGAAGGGGAGGGAGGAAGG + Intergenic
1165107375 19:33479573-33479595 GGGGCCTATTGGAAGGTGGAGGG - Intronic
1165354704 19:35296247-35296269 GGGGCCAGGGGGTAGGGGCAAGG + Intronic
1165475218 19:36026492-36026514 GGCTGCGAGGGGAAGGAGGACGG - Intronic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1165674067 19:37706282-37706304 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
1165763058 19:38333790-38333812 GGGGCCAAGAGGTAGGATGAGGG + Intergenic
1165847392 19:38827054-38827076 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
1165847404 19:38827084-38827106 GGGAGGGAGGGGAAGGAGGAAGG + Intronic
1166104175 19:40589460-40589482 GGGGCCCAGGCGGAGGGGGAGGG + Intronic
1166297598 19:41896656-41896678 GGGGCAATGAGGAAGCAGGAGGG - Intronic
1166369175 19:42291915-42291937 GGGGACACAGAGAAGGAGGAGGG - Intronic
1166385621 19:42378916-42378938 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
1166518323 19:43463451-43463473 GGGGCCAAGAGGCAGCAGGAGGG - Intronic
1166532545 19:43551732-43551754 GGGGCAAAGGGGAACGAGACAGG + Intronic
1166668745 19:44697476-44697498 GGGGCCAGGGAGGTGGAGGATGG + Intergenic
1166696075 19:44852030-44852052 GGGGCTGTGGGGACGGAGGATGG - Intronic
1166773220 19:45297175-45297197 GGGTCCGAGGGGCTGGAGGAGGG + Intronic
1167001267 19:46746725-46746747 GGGGCGAAGTGGGAGGAGGGGGG - Exonic
1167048644 19:47066259-47066281 GGGGGCAAGGGGAGGCAGGCTGG - Exonic
1167295552 19:48646884-48646906 GGGGAGGAGGTGAAGGAGGAGGG + Intergenic
1167304961 19:48702975-48702997 TGGGCCATGGGAAAGGAGAAAGG - Exonic
1167360965 19:49030150-49030172 GTGGCCCAGGGGTAGGTGGAGGG + Intronic
1167363450 19:49042542-49042564 GTGGCCCAGGGGTAGGTGGAGGG + Intergenic
1167417881 19:49386710-49386732 GGGAGGAAGGGGAGGGAGGAGGG + Intergenic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167470000 19:49670341-49670363 GGGGCTCCGGGGAAGGAGGCGGG - Exonic
1167576534 19:50320473-50320495 GGGGCCAAGGGAAGGGGGAAGGG + Intronic
1167579073 19:50331490-50331512 GGGGAGAAGGGGAAGAAGAAGGG - Intronic
1167579084 19:50331530-50331552 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579096 19:50331570-50331592 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167579108 19:50331610-50331632 GGGGAGAAGGGGAAGAAGGAGGG - Intronic
1167607605 19:50489756-50489778 GGGCCCAGGAGAAAGGAGGAAGG + Exonic
1167621697 19:50564366-50564388 GGAGCCACGGGGAAGGAGCAGGG + Intronic
1167741119 19:51325551-51325573 GGGGCCAGGGAGAAGGGGGCTGG - Intronic
1167804060 19:51767084-51767106 GGGGCCTACCGGAAGGTGGAGGG - Intronic
1168103326 19:54152631-54152653 GGGGCCACAGGGAAGGGGGATGG + Intronic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168296654 19:55380322-55380344 GGGGGAAGGGGGAAGGGGGAGGG - Intronic
1168696940 19:58408977-58408999 GGAGCCGCTGGGAAGGAGGACGG - Exonic
1168703091 19:58453140-58453162 GGCGCCATGTGGAGGGAGGAAGG + Intronic
925079634 2:1053893-1053915 GGGGACAAAGGGAGGGAGGGAGG - Intronic
925246403 2:2387452-2387474 GGGGGCAGGGGGAAAGGGGAGGG - Intergenic
925418466 2:3690415-3690437 GGGGGGGAGGGGAAGGGGGAGGG - Intronic
925577011 2:5370531-5370553 TGGGTCAAGGAGAAGGAGAAAGG - Intergenic
925646066 2:6037924-6037946 GGGGAACAGGGAAAGGAGGAAGG - Intergenic
925755413 2:7128128-7128150 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755436 2:7128169-7128191 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755459 2:7128210-7128232 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755489 2:7128264-7128286 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925947224 2:8876712-8876734 GGGGGAAGGGGGAAGGGGGAAGG + Intronic
925988446 2:9234666-9234688 AGAGCCAAGGTGAAGGAAGATGG + Intronic
926023104 2:9514363-9514385 GGGGGGAGGGGGAAGGGGGAAGG + Intronic
926099013 2:10101927-10101949 GGGGTCAAGGAGGAGGGGGAGGG + Intergenic
926124508 2:10263916-10263938 GGGGGGAGGGGGAAGGGGGAAGG + Intergenic
926156237 2:10455548-10455570 GGAGCCGAGGGGAAGGATGCTGG - Intergenic
926197983 2:10775152-10775174 GGGGACAATGAGAGGGAGGAGGG - Intronic
926225104 2:10961620-10961642 GGGGCCCGGAGGAAGGCGGAGGG - Intergenic
926242930 2:11101779-11101801 GGGGCTGAGGGGAAGAAGGGAGG + Intergenic
926334486 2:11853040-11853062 AGGGGGAAGGGGAAGAAGGAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926893038 2:17654813-17654835 TGGGGCAAGGGGCAGTAGGAGGG - Intronic
927452817 2:23223590-23223612 GGGGGGAAGGGGAAGGATTATGG - Intergenic
927645948 2:24877104-24877126 GGGGACATGGGGGAGGAGGAGGG - Intronic
927679817 2:25132023-25132045 GGGGCCAAGGGGAGGAAAGAGGG + Intronic
927692588 2:25218852-25218874 GTGTCCAAGGGCAAGGAGAAGGG - Intergenic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927941248 2:27104245-27104267 AGGGCCAAGGGCTGGGAGGAGGG - Intronic
928135092 2:28682158-28682180 GAGGCCAAGGGGACAGAAGATGG + Intergenic
928249572 2:29663425-29663447 GAGGACGATGGGAAGGAGGAAGG - Intronic
928280074 2:29938154-29938176 GAGGGCAGGGGGAAGGGGGAGGG + Intergenic
928394534 2:30933359-30933381 GGAGCCATGGGGAAGCAGGCTGG + Intronic
928842442 2:35626468-35626490 GGATGCAAGGGGTAGGAGGATGG - Intergenic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929234710 2:39593678-39593700 GGGGCCATGGGGAAGGAGGTGGG + Intergenic
929428809 2:41870000-41870022 GGGGCAGAGGGGACGGTGGAGGG - Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929901941 2:46012519-46012541 GGGGACAGGGGGAAGTGGGAGGG - Intronic
930022830 2:47011877-47011899 GGAGCCAAGAGGAAGGAGAGGGG - Intronic
931055243 2:58461945-58461967 GGGGCCAAAGGGTTGGAGAACGG + Intergenic
931180747 2:59898068-59898090 GGGGAACAGGGGAAGAAGGAAGG + Intergenic
931513147 2:63022276-63022298 GGAGGAAAGAGGAAGGAGGAAGG - Intronic
932129978 2:69178564-69178586 GGGGCCAGGGGCAAGAGGGAGGG + Intronic
932174349 2:69585965-69585987 GGTGCCAGAGGGAAGGTGGAGGG - Intronic
932504898 2:72219267-72219289 GGAGCAAGGGGGAAGGAGGAGGG + Intronic
932585092 2:73022625-73022647 GGGGGAAGGGGGAAGGGGGAGGG + Intronic
932585095 2:73022632-73022654 GGGGGAAGGGGGAGGGAGGAGGG + Intronic
932623919 2:73283829-73283851 GGGGCCAGAGGGAGGGGGGAGGG - Intronic
932627485 2:73309119-73309141 AGGGACAAGGGGCATGAGGAAGG - Intergenic
932744893 2:74325869-74325891 GGGGGAAAGGGGAAGGGGAAGGG + Intronic
932812292 2:74835121-74835143 AGGGCCGCGGGGAAGGAGAAGGG - Intronic
932887554 2:75560976-75560998 GGAGCCAAGCGGGTGGAGGAGGG - Intronic
932911489 2:75810630-75810652 GGGGAAAAAGGGAGGGAGGAAGG - Intergenic
933028198 2:77289864-77289886 GGGGCCAAGAGGAAGGCTAAAGG - Intronic
933061989 2:77749240-77749262 GGGGGCAGGGGGATGGGGGAGGG + Intergenic
933099411 2:78233187-78233209 GTGGCTAAAGGAAAGGAGGATGG + Intergenic
933772572 2:85753710-85753732 TGGGCCAAGGGGATGGGGGTGGG + Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934153385 2:89171774-89171796 GGAGACAGGAGGAAGGAGGAAGG - Intergenic
934213851 2:90010157-90010179 GGAGACAGGAGGAAGGAGGAAGG + Intergenic
934480386 2:94635167-94635189 AGGGCCAAGGGGAAGAAAGATGG + Intergenic
934490189 2:94756978-94757000 TGGGCCAAGGGGAACCATGAGGG - Intergenic
934647590 2:96068103-96068125 GGGGCCATGGGTGAGGGGGAAGG + Intergenic
934732203 2:96666443-96666465 GGGGCCAAGGAGAAGAGGAAAGG - Intergenic
934735710 2:96688903-96688925 GGGGTGAAGGGGAGGGAGCAGGG - Intergenic
934736285 2:96691448-96691470 CTGGCCAAGGGCGAGGAGGAGGG + Intergenic
934840966 2:97623923-97623945 GGGGCCATGGGTGAGGGGGAAGG + Intergenic
934991543 2:98925114-98925136 GAGGCAAGAGGGAAGGAGGAGGG + Intronic
935008989 2:99113367-99113389 GGGGGAGAGGGGAAGGTGGAGGG + Intronic
935011586 2:99141270-99141292 GGAGCCCGCGGGAAGGAGGAGGG + Intronic
935171276 2:100612917-100612939 GAGGCCATGGGGCATGAGGAGGG - Intergenic
935234354 2:101125924-101125946 GGACTCAAGGGGAAGGAGAATGG - Intronic
935296669 2:101655984-101656006 GGGGCCAGGGGGAGGGGGGTGGG - Intergenic
936537735 2:113324972-113324994 GGGGCCGAGGGGGCGGAGGGAGG - Intergenic
937104410 2:119296551-119296573 GGGGACAAGGGGGAAGAGCAGGG - Intergenic
937259841 2:120578329-120578351 GGGCCCTGGGGGAAGGACGAAGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
937973225 2:127565786-127565808 GGGGCCATGGGGATGGATGTGGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938143357 2:128813554-128813576 GGAGCCAAGGGGAATGGGCAGGG - Intergenic
939547883 2:143575906-143575928 GGGGCAAAAGGGAAGGAAAAAGG + Intronic
939874525 2:147562541-147562563 GGGGCCAAGGGGAGAGGGGAAGG - Intergenic
939901646 2:147857972-147857994 GGGGCCTATGGGAGGGAGGAGGG - Intronic
940524786 2:154799483-154799505 GGGGTCTAGGGTGAGGAGGATGG + Intronic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941060117 2:160837425-160837447 GGGGGTCAGAGGAAGGAGGATGG - Intergenic
941234021 2:162946623-162946645 GGGAAGAAGGGGAAGGAGAAGGG + Intergenic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
941924603 2:170882918-170882940 GGAGGGGAGGGGAAGGAGGAAGG + Intergenic
942141377 2:172980521-172980543 GGAGCCAAGGGGGAGGAGCATGG + Intronic
942729202 2:179045152-179045174 GGGGTCGAGGGGAGGGGGGAGGG - Intronic
942751007 2:179287324-179287346 GGGGCCTAGTGGAGGGTGGAGGG + Intergenic
942800740 2:179872607-179872629 GGGGAGGAGGGGGAGGAGGAGGG + Intergenic
942825865 2:180175580-180175602 GGGGCAGAGGGGAGTGAGGAAGG - Intergenic
943786454 2:191883032-191883054 TGGGCAAAGGTGAAGGAGGCAGG - Intergenic
943824647 2:192373450-192373472 GGCGACAAGGCGAAGAAGGAGGG + Intergenic
944035997 2:195295253-195295275 GGGGGCATGGGGTAGGGGGAGGG + Intergenic
944240453 2:197480692-197480714 GGTAACAAAGGGAAGGAGGAGGG + Intergenic
944687180 2:202127960-202127982 AGGGGCTAGGGGAGGGAGGAGGG - Intronic
944774368 2:202947477-202947499 GGGGGTAGGGGGAAAGAGGATGG + Intronic
944848712 2:203695111-203695133 AGGCCCCAGGGGAAAGAGGAGGG + Intergenic
945064437 2:205936725-205936747 GGGGCCGGAGGGAAAGAGGAAGG + Intergenic
945176271 2:207046808-207046830 GGCACCAAAGGGCAGGAGGAGGG + Intergenic
945240998 2:207676887-207676909 GGGGCCAGGGGGAATCAGGAAGG - Intergenic
945338947 2:208628363-208628385 GGGAACAAGGGGAAGAAAGAAGG - Intronic
945790866 2:214304011-214304033 GGGGCCTACTGGAAGGTGGAGGG - Intronic
946096164 2:217275757-217275779 GGGACCAGAGGGAAGGAGCAAGG - Intergenic
946103245 2:217345691-217345713 GGGGCCTACTGGAAGGTGGAGGG - Intronic
946131345 2:217609446-217609468 GAATCCAAGGGGAAGGAGGAAGG + Intronic
946312039 2:218887443-218887465 GAACCTAAGGGGAAGGAGGATGG - Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
946541992 2:220694957-220694979 GGTGTCAAAGGGAAGGAGGTGGG - Intergenic
947011099 2:225567823-225567845 GAAGCCAAGGGGAAAAAGGATGG + Intronic
947142149 2:227029294-227029316 GTCACCAAGAGGAAGGAGGAAGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947187308 2:227466855-227466877 GGGGCTGGGGGGAAGGAAGAGGG + Intergenic
947415607 2:229892199-229892221 GAGGATAATGGGAAGGAGGAAGG + Intronic
947511007 2:230754385-230754407 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511014 2:230754403-230754425 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947511020 2:230754421-230754443 GAGGGGAAGGGGAAGAAGGAGGG - Intronic
947511027 2:230754439-230754461 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947612336 2:231531821-231531843 GGGGGCAGTGGGGAGGAGGAGGG - Intergenic
947650375 2:231781283-231781305 GAGGCTAGGGGGAAGGAGAAGGG - Exonic
947817657 2:233048807-233048829 GGGGACAATGGGATGGAGGCGGG + Intergenic
948056527 2:235012813-235012835 TGGTCCAAGGAGCAGGAGGAAGG + Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948231485 2:236352182-236352204 GGGGCCAATGAGCAGGAGGGGGG + Intronic
948253802 2:236551611-236551633 GGGGGAAAGGGGAAGGAGTCTGG - Intergenic
948283815 2:236769028-236769050 GGAGCCAAGGGGAATAGGGAGGG + Intergenic
948344332 2:237282667-237282689 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948344346 2:237282697-237282719 GAGGGGAAGGGGAAGGAGAAGGG + Intergenic
948424442 2:237878287-237878309 AGGGCCAGGGGCAGGGAGGAGGG + Intronic
948432345 2:237927722-237927744 GGGGGCTAGGGGAAGTAGGCAGG + Intergenic
948577647 2:238964986-238965008 GGAGGAAAGAGGAAGGAGGAAGG - Intergenic
948670627 2:239566428-239566450 GCGGCCAAGGTGAGGGAAGATGG + Intergenic
948783624 2:240339918-240339940 GTGGCCAAAGGGAAGAAGCAAGG - Intergenic
948911106 2:241003110-241003132 GGGGCCCGGGGGAGGGCGGAGGG - Intronic
948989815 2:241548109-241548131 GGGGTAAAGTGGGAGGAGGATGG - Intergenic
949047319 2:241877897-241877919 GGGGGAAGGGGGAAAGAGGAAGG - Intergenic
949049377 2:241888828-241888850 GGGGCCAGTGAGAGGGAGGATGG - Intergenic
949049961 2:241892367-241892389 AGGGGCAAGGGGAAGAGGGATGG - Intergenic
1168857160 20:1016766-1016788 GGGGCCAGGGGAAGAGAGGAGGG - Intergenic
1168958333 20:1850071-1850093 GGGGAGGTGGGGAAGGAGGATGG + Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169178631 20:3542573-3542595 AGGGAGAAGGGGAAGGAGAAAGG - Intronic
1169673731 20:8132201-8132223 GGGGGCGGGGGGGAGGAGGAGGG + Intronic
1169856502 20:10109324-10109346 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
1170587489 20:17745700-17745722 GGGGGCAGGGGGAATGAGGGGGG + Intergenic
1170607287 20:17883654-17883676 AGGGGCAAGGGGAGGGAGAAGGG + Intergenic
1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG + Intronic
1171265564 20:23769334-23769356 TGGGCCAAGGGGAAATGGGAAGG - Intergenic
1171284087 20:23923535-23923557 GGGGCCAAGTGGAAGGTGCAGGG + Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171812566 20:29757036-29757058 GGGGACAAGGGGGAGAGGGAAGG + Intergenic
1171868645 20:30508780-30508802 GGGGACAAGGGGGAGAGGGAAGG + Intergenic
1171906675 20:30905251-30905273 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
1172006459 20:31821773-31821795 GGGGCCAGGGGGAGGGAAGGGGG + Intronic
1172113990 20:32563073-32563095 AGGGTGAAGGGGAAGGAGGGTGG + Intronic
1172173411 20:32958356-32958378 GGGGCAGAGGGCATGGAGGAGGG + Intronic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172387206 20:34542337-34542359 GGGGACTAAGGGAAGGTGGAAGG - Intergenic
1172389007 20:34553453-34553475 GAGGCCAACGTGGAGGAGGAGGG - Intronic
1172459015 20:35101209-35101231 GCTGGCAAGGGGAAGGAGGAAGG - Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172762813 20:37333897-37333919 AAGGCCAAGGGGAAGGGGAAGGG + Intergenic
1172770433 20:37379257-37379279 GGGGTCAAGGGGAAGCAGTGGGG - Intronic
1172785226 20:37464303-37464325 GGGGCCCAGGGGAACAAGGGGGG - Intergenic
1172801006 20:37576198-37576220 GAGACCAAGAGCAAGGAGGAAGG - Intergenic
1172877234 20:38172109-38172131 GGAGCCAAGGGAAGGGAGAAAGG + Intergenic
1173120823 20:40287404-40287426 GGTGCCAGGGGGAAGGAGGCAGG - Intergenic
1173294280 20:41742199-41742221 GGAAGGAAGGGGAAGGAGGAAGG - Intergenic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173427372 20:42954874-42954896 GGAGAGAAGGGAAAGGAGGAGGG + Intronic
1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG + Intronic
1173817270 20:45997824-45997846 GGGGCCCAGAGGGAGGAGCAGGG + Intergenic
1174058194 20:47814071-47814093 AGGGCTGAGGGGAAGGAGAATGG + Intergenic
1174114582 20:48218228-48218250 GGGGGCAAGGGGAAGGAGCTGGG - Intergenic
1174137553 20:48391031-48391053 GGAGAGGAGGGGAAGGAGGAAGG + Intergenic
1174149717 20:48477610-48477632 GAGGGCGAGGGGAAAGAGGAAGG + Intergenic
1174216619 20:48921234-48921256 GGCGTCAGGAGGAAGGAGGAAGG - Intergenic
1174476842 20:50801820-50801842 GGGACTGAGGGGAAGGAGGATGG + Intronic
1174881953 20:54289501-54289523 GGGGCCTTGGGGAAGGGGGAAGG + Intergenic
1175100616 20:56576229-56576251 GAGGGCAAGGGGAAGGGGCAGGG - Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120157 20:56710814-56710836 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120182 20:56710889-56710911 GAGGAAGAGGGGAAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175140848 20:56859471-56859493 GGAGCAAAGGGGAGGGAAGAAGG - Intergenic
1175194851 20:57236020-57236042 GGTGCCAGGAGGGAGGAGGAGGG - Intronic
1175224883 20:57439234-57439256 GGGGTCAGGGGGTAGGAGGGTGG - Intergenic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1175333479 20:58179957-58179979 AGGGCTAGGGGGAAGCAGGACGG + Intergenic
1175692326 20:61074510-61074532 GAGGCCAAGGGAAAGGACAATGG - Intergenic
1175825367 20:61933862-61933884 GGGGTAAAGGGCAAGGAGGTGGG + Intronic
1175841067 20:62027874-62027896 GGGGTCAAGGGGCAGGCGGGAGG - Intronic
1176270389 20:64233154-64233176 GGAGGGAAAGGGAAGGAGGAAGG - Intronic
1176411866 21:6453550-6453572 AGGGGCACGGGGTAGGAGGAAGG + Intergenic
1176512477 21:7759136-7759158 GGAACCAAGGGCAGGGAGGATGG + Intronic
1176548928 21:8213329-8213351 GGGGCGGCGGGGGAGGAGGAGGG - Intergenic
1176551341 21:8223823-8223845 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
1176567857 21:8396362-8396384 GGGGCGGCGGGGGAGGAGGAGGG - Intergenic
1176570250 21:8406822-8406844 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
1176578159 21:8451009-8451031 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
1176808742 21:13516325-13516347 GCGGCAAAGGGAAAAGAGGATGG + Intergenic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1177205491 21:18005820-18005842 GGGGCCTGTGGGATGGAGGAAGG + Intronic
1177365407 21:20128750-20128772 GGGGCTAGGGGGCTGGAGGAGGG + Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178038747 21:28615316-28615338 GGGGAAAAGGGGAAGGAGGGAGG - Intergenic
1178093686 21:29191058-29191080 GTGGCCAAGGCGAAGGGGGCAGG - Intergenic
1178646590 21:34389660-34389682 GGAACCAAGGGCAGGGAGGATGG + Intronic
1178668543 21:34569954-34569976 GAGGCAAAGGGGCTGGAGGAAGG + Intronic
1178837612 21:36111830-36111852 GGGGGCAAGTGAAGGGAGGAAGG + Intergenic
1179054179 21:37916214-37916236 GGGGCCAAGGGAGGGGCGGAGGG + Exonic
1179081838 21:38178635-38178657 GGGGAGGAGGGGGAGGAGGAGGG + Intronic
1179111182 21:38446878-38446900 GGGGGCAAGGAGAAGGCAGATGG - Intronic
1179215916 21:39366937-39366959 GGGGAAAGGGGGAAGGAGGAGGG - Intergenic
1179289158 21:40003728-40003750 GGAGCCAAGGGGAAGGAAGTGGG - Intergenic
1179540617 21:42081245-42081267 GAGGCCCCGAGGAAGGAGGAGGG + Intronic
1179635602 21:42706770-42706792 GGGGTGAAGGGGATGGAGGGGGG - Intronic
1179687360 21:43061872-43061894 AGGGGCACGGGGTAGGAGGAAGG + Intronic
1179787810 21:43739880-43739902 TGGGGTAAGGGGTAGGAGGAGGG - Intronic
1179921889 21:44512021-44512043 GGGCCCAAAGGCATGGAGGACGG + Intronic
1180303617 22:11055943-11055965 GAGCCCTAGGGGCAGGAGGAGGG + Intergenic
1180315261 22:11272144-11272166 GGGGACAAGGGGGAGAGGGAAGG + Intergenic
1180340086 22:11611326-11611348 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
1181119855 22:20658390-20658412 AGGGCGAGCGGGAAGGAGGAAGG + Intergenic
1181474312 22:23159049-23159071 GGAGCCATGGGGAGGGAGGGAGG + Intronic
1181581201 22:23829061-23829083 GGGCTCAAGGGGAAGGAGGCTGG + Intronic
1181644939 22:24226047-24226069 AGGGCCTGGGGGAAGGCGGATGG - Intronic
1182077849 22:27507009-27507031 GGTGGCAGGGGGAAGGAGAAAGG - Intergenic
1182102978 22:27670721-27670743 GGGGGAAGGGGGAAGGGGGAAGG - Intergenic
1182353872 22:29713457-29713479 GGGGCCAGGGGCAGGGAAGAGGG - Intergenic
1182429369 22:30290957-30290979 GGGGCTGAGGGGAAGGAGGCAGG + Intronic
1182557365 22:31136586-31136608 TGGGCCAAGGGGTAGGGGAAGGG - Intronic
1183064799 22:35355380-35355402 AGTGCTAAGGGGAGGGAGGAGGG + Intergenic
1183191937 22:36327221-36327243 GGAGCCAGTGGGAAGGAGGGTGG - Intronic
1183237109 22:36627185-36627207 AGGACCTGGGGGAAGGAGGAAGG + Intronic
1183255055 22:36756685-36756707 AGGGCCATGGGGAAGGGGGCTGG + Intergenic
1183273392 22:36875949-36875971 GGGGGAAAGGGGAATGAGGCTGG - Exonic
1183393063 22:37556779-37556801 GGGGCCTAAGGGAAGGAGGCAGG - Intergenic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183780879 22:39998145-39998167 AGGGCGAAAGGGGAGGAGGAAGG - Intronic
1183959351 22:41402022-41402044 GGGGTGGAGGGGAAGGAGAAGGG - Intergenic
1183983679 22:41557603-41557625 GGGGCCAAGAGAAAGGAGACTGG + Intergenic
1184019029 22:41808292-41808314 GGGACAAAGGGCAGGGAGGAAGG - Intronic
1184244035 22:43226957-43226979 GAGGCTGAGGGGGAGGAGGAGGG - Intronic
1184409702 22:44319419-44319441 GGGATGAAGGGGAAAGAGGAGGG + Intergenic
1184421173 22:44383771-44383793 GGGGCCAAGGGCAAAGGGGAGGG - Intergenic
1184596606 22:45517763-45517785 GGAGCAAAGGGGCAGGAGGGGGG - Intronic
1184599099 22:45532192-45532214 GGGGCCTGGTGGAGGGAGGAAGG + Intronic
1184628582 22:45757282-45757304 TGGGGCTAGGGGAGGGAGGAGGG - Intronic
1184671141 22:46012885-46012907 GGGGCCATGGGACAGGAGGGAGG - Intergenic
1184671334 22:46013643-46013665 GGGGCCTCTGGGAAGGCGGAGGG - Intergenic
1184766071 22:46573257-46573279 GGGGCCAGGGCTAGGGAGGAAGG - Intergenic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1184901991 22:47452034-47452056 GGGGAGAAGGGGGACGAGGATGG - Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
1185010273 22:48309049-48309071 GGAGCAGAGGGGAGGGAGGAGGG + Intergenic
1185066327 22:48633351-48633373 GGGGCCAGCGGGCAGGAGCATGG + Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1185272557 22:49935746-49935768 GGGGCAAAGGGGAGGGTGGGGGG + Intergenic
1185281466 22:49971762-49971784 GGGTCCCTGGGGCAGGAGGAGGG + Intergenic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
1185330304 22:50249276-50249298 GGGGCCCAGGGGGAGGGGGCTGG + Intronic
1185421169 22:50735199-50735221 GGCGCCATGGAGAAGGACGAAGG - Intergenic
1203256364 22_KI270733v1_random:140767-140789 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
949188122 3:1218285-1218307 GGAGCCAAGGAGAAGGAGGGTGG + Intronic
949240871 3:1869964-1869986 GGGGCCAATTGGAGGGTGGAGGG + Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950447473 3:13046650-13046672 CGGGCCATGGAGAGGGAGGAGGG - Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
950657348 3:14444895-14444917 GGGACCAAGGGGAAGAATGGGGG - Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
951981785 3:28575239-28575261 GGGTCGATGGGGTAGGAGGAAGG - Intergenic
952259288 3:31724144-31724166 AGAGAAAAGGGGAAGGAGGAGGG + Intronic
952277794 3:31894300-31894322 GAGGACAAGGGGAGGCAGGAAGG + Intronic
952284436 3:31954585-31954607 GGGGGCAGGGGGAAGGATGGTGG + Intronic
952772765 3:37017238-37017260 GGGGCAAAGGGAAGTGAGGAGGG + Intronic
952786194 3:37157560-37157582 GGGGAAAAGAGGAAGGAGGGAGG + Intronic
953003181 3:38953246-38953268 GAGGCCCATGGGAAGGTGGAGGG + Intergenic
953432886 3:42854208-42854230 GGGGCACAGGGGAGGTAGGATGG + Intronic
953496309 3:43390276-43390298 AGGGCAGTGGGGAAGGAGGAGGG - Intronic
953683467 3:45057851-45057873 GGGGACAACTGGAAGCAGGAAGG + Intergenic
953796661 3:45991452-45991474 GGGGAAGAAGGGAAGGAGGAGGG - Intronic
954147677 3:48642327-48642349 GGGGCCTGGGGCAGGGAGGAGGG - Intronic
954411435 3:50372930-50372952 GGAGCCAAGGGGAAGCTGGGAGG + Intronic
954411764 3:50374121-50374143 GGAGGTAAGGGGAAGGAGGAAGG + Intronic
954449361 3:50563363-50563385 GGGTCTCAGGGGAGGGAGGAGGG - Intronic
954685231 3:52366653-52366675 GGGGCCAAGGGGAGGGGGAGGGG - Intronic
954693848 3:52410135-52410157 GGGGCGAAGGGGAGGGACGGGGG + Exonic
954706177 3:52481781-52481803 GGGCACAAGGGGAGTGAGGAGGG - Intronic
954747920 3:52797433-52797455 GGGGCCAAGGGGAAGAGGCTGGG + Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955539741 3:59961708-59961730 GGGGGCGAGGGGAAGCAGGGTGG - Intronic
955570191 3:60296213-60296235 GGGGAAGGGGGGAAGGAGGAGGG + Intronic
955845380 3:63157025-63157047 GGGGCTTAGGGGAGAGAGGAGGG + Intergenic
956126615 3:66016977-66016999 GGGGCCAGGGGAAAGGGGAATGG + Intronic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956420897 3:69085438-69085460 GGGCCCTAGGGGAAAGAGGACGG + Intronic
956440904 3:69279690-69279712 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440915 3:69279721-69279743 GGGGAAGAGGAGAAGGAGGAGGG - Intronic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957025186 3:75173632-75173654 GGAGGCAAGCTGAAGGAGGAAGG + Intergenic
957383882 3:79470410-79470432 TGGGGCATGGGGAGGGAGGAGGG + Intronic
957755660 3:84483081-84483103 GAGGCTGAGGGGAAAGAGGATGG + Intergenic
959107620 3:102082613-102082635 GGGGCCTATTGGAAGGTGGAGGG + Intergenic
959133902 3:102392558-102392580 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
959539742 3:107524810-107524832 GGGGCGAAGGGGAAGGTGGGTGG + Intronic
960378851 3:116935419-116935441 GAAGCCAAGGGGAAGGGGGCAGG - Intronic
960846590 3:122009613-122009635 AGGGCCAAGGAGAAAGAGGTTGG + Intronic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
961200994 3:125045289-125045311 GAGGCCGAGGGGAAGGAAGTAGG - Intronic
961325171 3:126105291-126105313 TGGGCCAAGGGGGAGCAGGAGGG - Intronic
961463118 3:127065558-127065580 GGAGCCACGCTGAAGGAGGAAGG - Intergenic
961645195 3:128389111-128389133 GGAGCCATGGGGATGGAGGCTGG + Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961735803 3:129001577-129001599 GGGGCGAAGGGACCGGAGGAGGG + Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
962259762 3:133895212-133895234 GGGGCCAAGGGTGAGGACGGAGG - Intronic
962650219 3:137480918-137480940 GGGGCCCAGGGGCAGGGGGTGGG - Intergenic
963004329 3:140711885-140711907 GGGGCCAGGGAGAAGGCGGTTGG - Intergenic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963271164 3:143287076-143287098 GGGACCAGAAGGAAGGAGGAGGG - Intronic
963296111 3:143548322-143548344 GGAGGAAAGGGGTAGGAGGAAGG + Intronic
963676376 3:148316531-148316553 TGGGCTAAGGGAAAGGTGGAGGG + Intergenic
964358208 3:155869925-155869947 GTTGCCAAGGGGTAGGTGGAGGG + Intergenic
964594537 3:158409122-158409144 GGGGCCTATTGGAAGGTGGAGGG + Intronic
964600626 3:158497206-158497228 GGGGCTAGGGGGGAGGGGGAAGG - Intronic
964671357 3:159229741-159229763 GGGGAGGAGGGGGAGGAGGATGG - Intronic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
964920748 3:161892567-161892589 GTGGAAAAGGGGAAGGAGAAAGG + Intergenic
965783034 3:172307826-172307848 TGGGCAAAGGGGTGGGAGGAGGG + Intronic
965830560 3:172782691-172782713 GGGGCCTACTGGAAGGTGGAGGG - Intronic
966398842 3:179527149-179527171 GGGGTGGAGGGGAAGGGGGAGGG + Intergenic
966402367 3:179561420-179561442 GGGGAAAAGGGGAAGCAGGTGGG - Intergenic
966799324 3:183748221-183748243 GGGGACAAGGGGAAGGGGAAAGG - Intronic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
966932992 3:184687669-184687691 GGGGAGGAGGGGAGGGAGGAAGG + Intergenic
966989557 3:185215491-185215513 GCGGCCAAGGGGAAGAAAAAAGG + Intronic
967736201 3:192955184-192955206 GGGGCCAAGGACAAGGAGTCAGG + Intergenic
967818287 3:193817050-193817072 AGAGCCTAGGGGGAGGAGGAGGG + Intergenic
968132413 3:196199255-196199277 TGGGCGAAGGGGAGAGAGGAGGG - Intronic
968135647 3:196217787-196217809 GGGGGCTGGGGGAAGGGGGAGGG - Intronic
968546229 4:1200392-1200414 GGGAGCAAGTGGAGGGAGGAAGG + Intronic
968622215 4:1608939-1608961 GGGCCCAAGGAGGAGCAGGAGGG + Intergenic
968624736 4:1622036-1622058 AGGGCAGAGGGGAAGGAGGAAGG - Intronic
968650103 4:1757069-1757091 GGCACCAAGAGGAAGGAGGATGG - Intergenic
968701688 4:2060619-2060641 GGGGGGAGGGGGGAGGAGGAAGG - Intronic
968708460 4:2095181-2095203 GGGGCTAGGGGGTAGGGGGAAGG + Intronic
968862815 4:3185955-3185977 GGGAGGAAGGGGAGGGAGGAAGG + Intronic
968944677 4:3657459-3657481 GGGCCCAAGGGGCAGAAGCACGG + Intergenic
968952722 4:3702982-3703004 GGCTCCAAGGAGAGGGAGGAGGG + Intergenic
968977040 4:3827485-3827507 GGGGCCAAGGGGTGGGGGGCGGG + Intergenic
969315206 4:6377724-6377746 GGGGCCCAGGTGAAGGAGGATGG + Intronic
969480719 4:7445534-7445556 GGGGCCGAGGGGAAGCACCAGGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969576832 4:8040971-8040993 GAGGCCAAGAGGAAGCAGCATGG + Intronic
969742329 4:9038893-9038915 GGGCTCAGGGGGAAGGTGGAAGG + Intergenic
969843571 4:9901674-9901696 GGGGCCAAGGGGCTGGTGGGGGG - Intronic
970006778 4:11418671-11418693 GGGGCTTAGGGACAGGAGGAAGG + Intronic
970011785 4:11467638-11467660 GGGGTGAAAGGGAAGAAGGAAGG + Intergenic
970205939 4:13655365-13655387 TGGGCCAAGGGGATGTAGGTGGG + Intergenic
970775836 4:19672861-19672883 GGGGGAAGGGGGAAGGGGGAAGG + Intergenic
970864664 4:20744618-20744640 GGGGTCAGGGGGATGGGGGAGGG + Intronic
970875374 4:20862957-20862979 GGGGCCTAGTGGAATGTGGAGGG + Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971354105 4:25878986-25879008 GGGGCCACGGGGTAGGAAGGGGG - Intronic
971393747 4:26209758-26209780 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971393765 4:26209807-26209829 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971633789 4:29031220-29031242 GGGGAGGAGGGGGAGGAGGAGGG - Intergenic
972151200 4:36093193-36093215 GGGGCCTATTGGAAGGCGGAGGG + Intronic
972300788 4:37783999-37784021 GGGGCCTATTGGAAGGTGGAAGG - Intergenic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
972738069 4:41865045-41865067 GGGGAGAAGGGCAAGGAGGGAGG + Intergenic
972919267 4:43917972-43917994 GGGGCCTAGAGCAAGGAGGTTGG + Intergenic
973162106 4:47031895-47031917 GGTGCTAAGGGGAAGAAGTAGGG - Exonic
973335794 4:48955350-48955372 GGAGGAAAGAGGAAGGAGGAAGG - Intergenic
973533030 4:51851679-51851701 GGAGCAAAGGGGAATGGGGAGGG + Intronic
973631454 4:52824562-52824584 AGGGCCAGGGGGAAGGAGCATGG - Intergenic
973707056 4:53591511-53591533 GGTGCCTGGAGGAAGGAGGACGG + Exonic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
976144949 4:82033037-82033059 GGGGACAGAGGGAAAGAGGAGGG + Intronic
976226180 4:82797461-82797483 GGGGCCCAGGGGAAGGGGAATGG + Intronic
976389714 4:84496357-84496379 GGGGGAGAGGGGAAGGGGGAGGG + Intronic
976397224 4:84569190-84569212 GGGGTCAAGTGGGTGGAGGATGG + Intergenic
977271771 4:94925976-94925998 GGAGGAAAGGGGAGGGAGGAAGG - Intronic
977805155 4:101288592-101288614 GGGAAGGAGGGGAAGGAGGAAGG + Intronic
978268570 4:106859061-106859083 AGGGTGAAGGGGGAGGAGGAGGG + Intergenic
978438066 4:108707161-108707183 GGGGGAAAGGGGCAGGGGGAGGG + Intergenic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
979252052 4:118576071-118576093 GGGGACAAAGGGAAGAAGCAGGG - Intergenic
979488646 4:121298403-121298425 GGGGCCAAGGAGAAGACTGAAGG - Intergenic
979972894 4:127159601-127159623 GGGGGAAAGGAGATGGAGGAAGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
981104300 4:140863201-140863223 GGGGCTCAGGCGAATGAGGAGGG + Exonic
981315677 4:143337372-143337394 GGGGCCAAGGGGAAAGAGACCGG - Intronic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981545142 4:145885943-145885965 GGCAGCAAAGGGAAGGAGGAGGG - Exonic
981550687 4:145938025-145938047 GGGGGCAAGAGAAGGGAGGAGGG - Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
982374387 4:154673594-154673616 GGGGACAAGAGGAAGGAAGAAGG + Intronic
983072987 4:163291812-163291834 GAGGAAAAGGGGAAGGAGAAGGG + Intergenic
983689773 4:170454067-170454089 GGGGCCTATTGGAAGGTGGAGGG - Intergenic
983704192 4:170638084-170638106 GGGGCCAGGGGGCAAGGGGAGGG - Intergenic
983998479 4:174213865-174213887 GGGGCCAGGGGGTGTGAGGACGG - Intergenic
984168961 4:176338286-176338308 GGAGTCAAGGGGAAGGATGGGGG + Intergenic
984201385 4:176724913-176724935 AGGGGCAAGGGTAGGGAGGATGG + Intronic
984288250 4:177761291-177761313 GGGGCCCAAGGGAATGAGGAGGG + Intronic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984703553 4:182833357-182833379 AGGGGAGAGGGGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984849874 4:184144118-184144140 GGGGCCTAGGCCTAGGAGGAAGG + Intronic
984857268 4:184205853-184205875 GGAACCAAGGGAAAGGATGAAGG + Intronic
984911425 4:184676908-184676930 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
984911429 4:184676915-184676937 GGGGGAAGGGGGAAGGGGGAAGG - Intronic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984952388 4:185017183-185017205 GGGCCCAAGGGGAAGGAGGGGGG - Intergenic
985599750 5:821142-821164 AGAGCCAAGGGGCTGGAGGAGGG - Intronic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986183625 5:5416971-5416993 GAGGGAGAGGGGAAGGAGGACGG + Intergenic
986362395 5:6993107-6993129 GAGGGCAAGGGGAAGGGGAAGGG - Intergenic
986668071 5:10120412-10120434 AGGTCCAAGGGGAAGGGCGAAGG + Intergenic
986669835 5:10132893-10132915 GGGTCCCAGGAGAAGGAGAAGGG - Intergenic
987125912 5:14812565-14812587 GGGCTCAAGGGCAAGGAAGAGGG - Intronic
987168492 5:15226218-15226240 GGGGCCGGGGGAAAGGAGAATGG - Intergenic
987508024 5:18798307-18798329 GGGGGCAAGGGGAAGACAGAGGG + Intergenic
987747965 5:22001631-22001653 GAGGGCAGAGGGAAGGAGGAGGG - Intronic
987950061 5:24663162-24663184 GGAGGCAGAGGGAAGGAGGAAGG - Intergenic
988994105 5:36697904-36697926 GAGGCCAAGGGGAACAAAGAGGG - Intergenic
989085618 5:37673054-37673076 GGGGCCTATGGGAGGGTGGAGGG - Intronic
989110385 5:37901764-37901786 GAGGGCAAGGGAAGGGAGGAAGG + Intergenic
989408485 5:41089790-41089812 GGGGATTAGGGGAAGGAGAAGGG - Intergenic
990333014 5:54745909-54745931 GGGGCCAAGGGAGGGGAGGCAGG - Intergenic
990690248 5:58355747-58355769 AGGGTGAGGGGGAAGGAGGAAGG - Intergenic
990869802 5:60418850-60418872 GGGGCTAAGGGGGAGGGGGATGG - Intronic
991217607 5:64173615-64173637 AGGGGAAAGGGAAAGGAGGAGGG - Intronic
991350188 5:65713288-65713310 GGAGGGAAGGGGAAGGAGAAGGG - Intronic
991434825 5:66587011-66587033 GGGGCTAAGGGGAGGGGAGATGG + Intergenic
991501518 5:67281992-67282014 GGGGGAAGGGGGAAGGAGGAAGG - Intergenic
991768143 5:70011435-70011457 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
991847381 5:70886517-70886539 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
992098352 5:73382219-73382241 GGGGCCGCGGGGAGGGAGGCTGG + Intergenic
992453203 5:76891814-76891836 GGGGCCTGGGAGAGGGAGGAGGG + Intronic
992765093 5:79991121-79991143 CGGGCCAGGGCGCAGGAGGAAGG - Intronic
993654296 5:90558751-90558773 GGGGAGAAAGGGGAGGAGGATGG + Intronic
993904957 5:93612319-93612341 GGGGGTAAGGGGAAAGGGGAGGG + Intergenic
994691630 5:103026831-103026853 GGGGCCTAGGGGAAGGTGGCAGG + Intronic
995027392 5:107439539-107439561 GGAGCAAGGGGGAAGGAAGATGG + Intronic
995554997 5:113318669-113318691 GGGGCCTATGGGAGGGTGGAGGG + Intronic
996096429 5:119404067-119404089 GGGGGCAAGGAGGAAGAGGAGGG - Intergenic
996423287 5:123285703-123285725 GGGGGGAAGGGGAAGGGGAAGGG - Intergenic
996873256 5:128215429-128215451 AGGGCCAAGGGGTAGGAGGCAGG - Intergenic
996993608 5:129667596-129667618 GGGAGCAAGGGGCAGGAGGGTGG - Intronic
997411849 5:133696719-133696741 AGGGCTGTGGGGAAGGAGGAGGG + Intergenic
997642770 5:135460369-135460391 GTGGCAAGGGGGAAGGAGGCTGG - Intergenic
997666678 5:135635037-135635059 GGGGCCACCGGGAAGAAGGATGG - Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998107476 5:139477550-139477572 GGGGCCAGGCGGATGGAGAATGG + Intronic
998263408 5:140648476-140648498 GGGGCCAAAGGGTTGGAGAACGG - Exonic
998451149 5:142235597-142235619 TGGGCAAAGGAGCAGGAGGAGGG - Intergenic
999151621 5:149430210-149430232 GGGGGAAGGGGGTAGGAGGAAGG - Intergenic
999829533 5:155305623-155305645 GATGCCCAGGGGAAGGAGGGGGG - Intergenic
1000192575 5:158925545-158925567 GGTGGCCAGTGGAAGGAGGAAGG - Intronic
1000209104 5:159095203-159095225 GGGGCTGAGGGGGCGGAGGAGGG - Intronic
1000440621 5:161259021-161259043 GGAGAAAAGGGGAAGGGGGACGG - Intergenic
1000497168 5:161999101-161999123 GGAGCCAAGGAGAATGAGGGAGG - Intergenic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001264253 5:170261011-170261033 TGGGCCAAGGCCAAGGTGGATGG + Intronic
1001268291 5:170291156-170291178 GAGGACAAGGGAAGGGAGGAAGG + Intronic
1001600173 5:172923368-172923390 GGGGAGGAGGGGGAGGAGGAGGG + Intronic
1001719828 5:173847834-173847856 GGGGCCTAGGGGAAGGTGTTTGG - Intergenic
1001929481 5:175662589-175662611 GGGGCAGAGGGGAAGCAGGGAGG - Intronic
1002045410 5:176538686-176538708 TGGGCCATGGGGCAGGGGGATGG + Intergenic
1002980104 6:2127719-2127741 GGGGCCTGGGGAAAGGACGAGGG - Intronic
1003162924 6:3651327-3651349 GGGGGAAAAGGGAGGGAGGAGGG + Intergenic
1003235787 6:4294446-4294468 GGGGGCAAGGTGAGGGAGGGAGG - Intergenic
1003276341 6:4656384-4656406 GAGGCCAGGGGTAAGGAGGATGG + Intergenic
1003381918 6:5632570-5632592 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1003409531 6:5850629-5850651 GGTGCAAACGGGAAGAAGGAAGG + Intergenic
1003487847 6:6595217-6595239 GGGGAAAAGGAGTAGGAGGAGGG + Intronic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003823917 6:9931240-9931262 GGGGCCTATTGGAAGGTGGAAGG + Intronic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1004300795 6:14455385-14455407 GGCTCCAAGGGCCAGGAGGAAGG - Intergenic
1004395696 6:15245251-15245273 GGGGCCCGGGGGGCGGAGGAGGG + Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005272949 6:24185853-24185875 GGAGTGAAGGGGATGGAGGAAGG - Intronic
1005695769 6:28351340-28351362 GAGCCCAAGTGGAATGAGGAGGG - Intronic
1005870207 6:29969885-29969907 GGGTCAAAGGGAAAGCAGGAAGG - Intergenic
1005878225 6:30032034-30032056 GGGGACAAAGGGAAGGTGGCTGG + Intergenic
1006152189 6:31995545-31995567 GGGTGCAAGGGCAAGCAGGAGGG + Intronic
1006158491 6:32028283-32028305 GGGTGCAAGGGCAAGCAGGAGGG + Intronic
1006263166 6:32894154-32894176 GGGGGAAGGGGGAAGGCGGAAGG - Intergenic
1006267082 6:32934588-32934610 GGGGCCCTGGGGAAGGAATATGG - Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006510127 6:34516967-34516989 GGGGTCAAGGGCAGTGAGGAGGG - Intronic
1006567608 6:34973841-34973863 GAGGGCAAGGGGAAGGGGAAGGG - Intronic
1006871649 6:37257536-37257558 GGGACCTATGGGAAGGAAGAGGG - Intronic
1006882793 6:37354325-37354347 GGGGCTCCGGGGAGGGAGGAAGG + Intronic
1006951984 6:37830249-37830271 TGGGGCAAGGGGGATGAGGATGG + Intronic
1007102148 6:39256525-39256547 GGGGCCAGGGAGGGGGAGGAAGG + Intergenic
1007103476 6:39267583-39267605 AGGGCTCATGGGAAGGAGGAGGG - Intergenic
1007110498 6:39310857-39310879 GGGGCCAGGGGGATGGGGGTGGG - Intronic
1007363241 6:41373281-41373303 GGGGCGAAGGGGCAGGCGGAGGG - Intergenic
1007414645 6:41684463-41684485 GGGGCCAACGGGGAGGAGGGAGG + Exonic
1007483781 6:42166879-42166901 GGGGCCGAGGGGAGGGAGGATGG - Intronic
1007698185 6:43747138-43747160 GGGGACATGGAAAAGGAGGAAGG - Intergenic
1007777960 6:44234260-44234282 GGGTCCAAGGGGGAGGAGGGGGG + Intergenic
1007781570 6:44257540-44257562 GGGGCCGCGGGGAGGGAGGCGGG - Exonic
1008367532 6:50699724-50699746 TAAGCCCAGGGGAAGGAGGAGGG - Intergenic
1008447388 6:51609202-51609224 GGGGCAAAGGGGAAAGAGAAGGG - Intergenic
1008621907 6:53279030-53279052 GTAGCCAAGGGGAAAGAGCATGG + Intronic
1008737117 6:54558405-54558427 GGGGGTAGGGGGAAAGAGGAGGG + Intergenic
1008853467 6:56052888-56052910 GGGGCCTACTGGAAGGTGGAGGG + Intergenic
1008863239 6:56176916-56176938 GGGAGGAAGGGGGAGGAGGAAGG + Intronic
1009382618 6:63051794-63051816 GGGGCCTATGGGAGGGTGGAAGG - Intergenic
1009481932 6:64169878-64169900 GGGGCTAAGTGTAAGGAAGAAGG + Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1009530548 6:64808035-64808057 GGGAAGAAGGGAAAGGAGGAAGG - Intronic
1009729437 6:67580883-67580905 GGGGCCAACCAGAAGGTGGAGGG - Intergenic
1009874562 6:69489538-69489560 GGGGCCTACTGGAAGGTGGAGGG - Intergenic
1010449526 6:75987445-75987467 GGGGGCAGGGGGGAGGGGGAGGG - Intronic
1011113014 6:83859603-83859625 GGAGCCAACGGGACGGAGGGAGG - Intergenic
1011200037 6:84826020-84826042 GGGGCCTATCGGAAGGTGGAGGG - Intergenic
1011277489 6:85643897-85643919 GGGGCCAAGGGGGAGGGGAGCGG + Intergenic
1011417427 6:87137290-87137312 GGGGAGGAGGGGAAGGGGGAAGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011821832 6:91262113-91262135 GGGGACAAGAGGGAGTAGGAAGG + Intergenic
1012825032 6:104137176-104137198 GGGGCCTATTGGAAGGTGGAAGG - Intergenic
1012872816 6:104692053-104692075 GGGGGGAAGGGGTAGAAGGAGGG + Intergenic
1013356705 6:109351546-109351568 CTGGCCAATAGGAAGGAGGAAGG + Intergenic
1013359693 6:109382526-109382548 GGGGCGAAGAGGAGGGAGGTGGG + Intronic
1013530425 6:111014521-111014543 TGGGCTAATGGGAAGCAGGAAGG + Intronic
1014097330 6:117474569-117474591 TGGGGCAGGGGGAGGGAGGAGGG + Intronic
1014134386 6:117871268-117871290 GGGGGCAAGCGGAAGGAGTGGGG + Intergenic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014459060 6:121673565-121673587 GGGAGCAAGGGGAAGGAAGGCGG - Intergenic
1014594379 6:123314831-123314853 GGGGCCAATTGGAGGGTGGAGGG + Intronic
1014884838 6:126767116-126767138 GGGGAGGAAGGGAAGGAGGAAGG - Intergenic
1015004482 6:128262575-128262597 GGGGGCAAGGCAAAGAAGGAGGG + Intronic
1015321535 6:131880919-131880941 GGGGCCATGGGTGAGGGGGAAGG - Intronic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1016369370 6:143356621-143356643 GGGACCAAGGGGAAAGAGAAGGG - Intergenic
1016724638 6:147348360-147348382 GGGGACAGGGAGTAGGAGGAAGG - Intronic
1016994842 6:149954467-149954489 CGGCCCCAGGGCAAGGAGGATGG + Intergenic
1017002407 6:150005393-150005415 GGGGCCGAGGTGGAGGGGGAGGG - Intergenic
1017003763 6:150014969-150014991 CGGCCCCAGGGCAAGGAGGATGG - Intergenic
1017103306 6:150866425-150866447 GGGGGCGAGGAGCAGGAGGAGGG + Intronic
1017290960 6:152736023-152736045 GGGGCCAAGGGGAAGCAAAGTGG + Intergenic
1017557057 6:155583066-155583088 TCTGCCATGGGGAAGGAGGATGG + Intergenic
1017873354 6:158504008-158504030 CGGGCCAGTGAGAAGGAGGACGG + Exonic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018125569 6:160679265-160679287 GGTGGCAAGGGACAGGAGGAGGG - Intergenic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018176715 6:161183848-161183870 GGGGACATGGGGAAGCAGGGAGG + Intronic
1018322905 6:162632486-162632508 GGGGACTATGAGAAGGAGGAGGG + Intronic
1018415924 6:163601941-163601963 GGGAAAGAGGGGAAGGAGGAGGG + Intergenic
1018419740 6:163631055-163631077 GGGCCCAGGGGAGAGGAGGATGG - Intergenic
1018682702 6:166277165-166277187 GTGGCCAAGCCGAAGGAGGCAGG - Intergenic
1018728818 6:166633906-166633928 TGGCCCATGGGGAGGGAGGAAGG + Intronic
1018814424 6:167320430-167320452 GAAGAAAAGGGGAAGGAGGAAGG - Intergenic
1018873393 6:167799846-167799868 GGGGCCACGAGGAAGGAGGGAGG + Intergenic
1018873880 6:167803564-167803586 GGGGGCTAGGGGAGGGAGCATGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019178605 6:170173789-170173811 AGGGCCAAGGGAGAGGAAGAAGG + Intergenic
1019404842 7:877753-877775 GGGGCCAAGGGAGAGGTGGAGGG - Intronic
1019479467 7:1259970-1259992 GGGGCCCAGGGGCAGCAGGCGGG - Intergenic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1019513040 7:1427743-1427765 GGGGCCAGCGGGACGGAGGCTGG - Intergenic
1019531674 7:1506536-1506558 GGGGAGGAGGGGGAGGAGGAGGG - Intergenic
1019549163 7:1593703-1593725 CTGGCCAAGGGGAAGGAAGGAGG + Intergenic
1019566095 7:1679746-1679768 GTGGCCAGGGGGCAGGGGGAAGG - Intergenic
1019647358 7:2138237-2138259 GGGTCCAAAGGGAAGGAGAAAGG + Intronic
1019812224 7:3173159-3173181 TGGGCCAAGGGGAGAGAGGCAGG + Intronic
1019855187 7:3598604-3598626 GGGGACAAGGGAAATGAGGAAGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020672217 7:11130585-11130607 GGAAACTAGGGGAAGGAGGAAGG - Intronic
1021315537 7:19144126-19144148 GTGGCGAAGGGGAGGGAGAAAGG + Intergenic
1021697121 7:23286335-23286357 GGGGAGAGGGGGAAGGAGGGAGG - Intergenic
1021825169 7:24543578-24543600 GGGGCCTAGTGGAGGGTGGAGGG - Intergenic
1022357049 7:29625780-29625802 GAGGGAAAGGGGAAGGAGAAGGG + Intergenic
1022566884 7:31412810-31412832 GGGATCAGGGGAAAGGAGGAGGG + Intergenic
1023003721 7:35840138-35840160 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023041695 7:36178423-36178445 GGGGCCCAGGTGTAGGGGGAGGG - Intronic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023302192 7:38784649-38784671 GGAGTTAGGGGGAAGGAGGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024051181 7:45624342-45624364 AGGGGCAGGGGGAAGGAGGGTGG + Intronic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024168011 7:46754146-46754168 GGGGCAATGGGGACAGAGGAAGG + Intronic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024702931 7:51924369-51924391 GGGGGTAGGGGGAAAGAGGAGGG - Intergenic
1024855754 7:53777022-53777044 GGGGCCAAGGGAAAGGGGAAAGG - Intergenic
1024895894 7:54261518-54261540 GGGGCCAGGTGGGAGGTGGATGG - Intergenic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1025611904 7:63081884-63081906 GGCTCAAAGGGGAGGGAGGATGG + Intergenic
1025769926 7:64495079-64495101 AGAGTCCAGGGGAAGGAGGAGGG - Intergenic
1025777355 7:64570509-64570531 AGGGGCAAGGGGGAGGGGGAAGG + Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026205727 7:68255617-68255639 GAGGAGAAGGGGAAGGAGAAGGG - Intergenic
1026251690 7:68676727-68676749 GGTGGGAAGGGGAAGGAAGAAGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026600522 7:71773759-71773781 GAGAACCAGGGGAAGGAGGATGG + Intergenic
1026638797 7:72106647-72106669 GGGGGAAAAGGGAAGGAGGGAGG + Intronic
1026767057 7:73166809-73166831 GGGGAGGAGGGGGAGGAGGAGGG - Intergenic
1026901072 7:74037842-74037864 GAAGCCAACGGGCAGGAGGAAGG + Intronic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027753801 7:82185471-82185493 GGGGGGGAGGGGGAGGAGGAGGG + Intronic
1027969958 7:85066516-85066538 GGGGCGGAGGGGCAGGAAGAAGG + Intronic
1028097646 7:86782173-86782195 AGGGTGAAAGGGAAGGAGGAAGG - Intronic
1028797907 7:94925761-94925783 GGGGAGAAGAGGAAGGAGAAAGG - Intronic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1029029603 7:97453898-97453920 GGGGGAAAGGGGAAAGGGGAGGG - Intergenic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1029412877 7:100426933-100426955 GGAGGAAAGGGGAGGGAGGAGGG - Intronic
1029537149 7:101163531-101163553 GAGGCCGAGGGGACAGAGGAGGG - Exonic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1029873043 7:103715892-103715914 GGGCCCTGGGGAAAGGAGGACGG - Intronic
1030021422 7:105278740-105278762 GGGGAAAAGGGGAAGGCAGAAGG + Intronic
1030022871 7:105293043-105293065 GAGGCCAAGGGGGAGGAGGGAGG + Intronic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030871283 7:114759311-114759333 GGAGCCAAGAGGAAGCAGGGAGG - Intergenic
1031024806 7:116668758-116668780 GGGGTGATGGGGCAGGAGGAAGG + Intergenic
1031059258 7:117031175-117031197 GGGGCCTACTTGAAGGAGGAGGG + Intronic
1031064596 7:117091253-117091275 AGGGCCAAGGGCAAGGAGAGGGG + Intronic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1032091850 7:128915235-128915257 GGGGCGGAGGGGAGGGGGGAGGG - Intergenic
1032201309 7:129825123-129825145 GGAGCACAGGGGCAGGAGGAAGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1033215108 7:139487686-139487708 GAGGTGAAGGGGAAGGGGGAGGG + Intergenic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1034193692 7:149229835-149229857 GGGGCAGAGGGAAAGGAGGGAGG + Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1034416941 7:150970284-150970306 GGGGCCATGGGGCAGCAGAAGGG - Intronic
1035154433 7:156900675-156900697 GGGAACAAGGGGAAGAATGATGG - Intergenic
1035389746 7:158496743-158496765 GGGGGCACAGGGAAGGTGGAGGG - Intronic
1035408645 7:158619095-158619117 AGGGGCTAGGGGACGGAGGATGG + Intergenic
1035630146 8:1101281-1101303 GGGGCCAAGGCCGAGGAGCAGGG + Intergenic
1035787647 8:2274907-2274929 GACTCCAAGGGGAAGGAGGGAGG - Intergenic
1035805163 8:2446809-2446831 GACTCCAAGGGGAAGGAGGGAGG + Intergenic
1035863084 8:3051432-3051454 GGGGCCTATGGGAGGGTGGAGGG + Intronic
1036203386 8:6787594-6787616 GGTGGCAAGTGGAGGGAGGAGGG - Intergenic
1036682324 8:10884566-10884588 GGAGGCAAAGGGAAGAAGGAAGG + Intergenic
1036711871 8:11085058-11085080 GAAGCCAAGGGGACGAAGGAAGG - Intronic
1036768820 8:11565266-11565288 GGGTTCAAGGGGAAGGAAGCGGG - Intergenic
1037496996 8:19450073-19450095 GGGGAGGAGGGGGAGGAGGAGGG + Intronic
1037521504 8:19684568-19684590 GGGTCCCAGGGGAGTGAGGAGGG - Intronic
1037598393 8:20373584-20373606 GGGGAAGTGGGGAAGGAGGAGGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037837672 8:22223873-22223895 GGGGCCAAAGGGAAGGTGGCAGG - Intronic
1037882436 8:22579606-22579628 GGGCCCAAGGGGAAGGCAGCCGG + Intronic
1037886652 8:22599391-22599413 AGGGGCGAGGGGAAGGGGGAGGG - Intronic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038134828 8:24773878-24773900 GGGGGAAAGGGGAGGGAGAAAGG + Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038795236 8:30703776-30703798 GGGGAGCAGGGGAAGGAAGAAGG + Intronic
1039279416 8:35967252-35967274 TGGGCAAAGGGCAAGAAGGAAGG - Intergenic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039442534 8:37605071-37605093 GGGGGCAAAGGGAAGGAGATGGG + Intergenic
1039477084 8:37844742-37844764 GGGGACAGGGGCAAGGAGAAGGG - Exonic
1039923614 8:41909928-41909950 AGGGCCAAAGGGAAGGGTGATGG + Intergenic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1040285549 8:46098764-46098786 GGGGCCTCGGGGAAGGGAGAGGG - Intergenic
1040534105 8:48290982-48291004 GGTGCACAGGGGAAGGAGGAGGG - Intergenic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041386835 8:57313153-57313175 GGGGTCAAGAGGAGGCAGGAAGG - Intergenic
1041624087 8:60005161-60005183 GGGGCTAGGGGGCTGGAGGAGGG + Intergenic
1041789628 8:61678749-61678771 AGATCCAAGGGGAAGGAGGAGGG - Intronic
1042324635 8:67515947-67515969 GGGGCCAAGTGGAAGAATCAGGG - Intronic
1042357997 8:67850585-67850607 GGGGCTAGGGGGAAAGGGGATGG - Intergenic
1042505487 8:69555258-69555280 GGAGGCCAAGGGAAGGAGGAAGG + Intronic
1042750655 8:72154265-72154287 GGGGCCAGGGAGGAGGAGGCAGG - Intergenic
1043817544 8:84820694-84820716 GGGGGCAAGGGGAAAGGGGAGGG - Intronic
1044331715 8:90928198-90928220 GGGGCCAGGGGGAATCATGAGGG - Intronic
1044402237 8:91786161-91786183 GGGAAGAAGGGGAAGGAGAAGGG - Intergenic
1044547644 8:93477329-93477351 AGGGCCAAGGGGAGTGAGGTGGG - Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1044927937 8:97224818-97224840 GGGGCCAAGGGGAAAGGGGCTGG + Intergenic
1045137062 8:99232859-99232881 GGGGCCAAGGAGGCGGGGGAAGG - Intronic
1045224902 8:100234925-100234947 GGGGCCCAGGATGAGGAGGAAGG + Intronic
1045273898 8:100684471-100684493 TCGGCCATCGGGAAGGAGGAGGG - Intergenic
1045757077 8:105556670-105556692 GGGGGAAAAGGGAAGGGGGAAGG - Intronic
1046178991 8:110618289-110618311 GGGGAGAAGGGGGAGGAAGAAGG - Intergenic
1046696107 8:117341282-117341304 GAGGCTAGGAGGAAGGAGGAGGG + Intergenic
1046870825 8:119204382-119204404 GGGAAGAAGGGGATGGAGGAGGG + Intronic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1047523730 8:125615298-125615320 GGAGGGAAGGGGAAGGAGAAGGG - Intergenic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1047800230 8:128301416-128301438 GGGGTCAAGGGTGAGAAGGAGGG + Intergenic
1047907008 8:129483149-129483171 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1047907024 8:129483185-129483207 GGGGAAGGGGGGAAGGAGGAAGG + Intergenic
1047987047 8:130246163-130246185 GGGGCGAAGGGGAGGGAGGTAGG - Intronic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048727023 8:137398168-137398190 GGTGGCAAGGGGGAGGGGGAGGG + Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049252885 8:141598642-141598664 GAGGCCAAGGGGGAGGAGGAAGG - Intergenic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG + Intronic
1049443904 8:142621461-142621483 GGGGCCAAGGAGGAGCAGGGGGG + Intergenic
1049472802 8:142783798-142783820 GGGTCCCAGGGGAGGCAGGATGG + Intergenic
1049475262 8:142794320-142794342 GGGGCCAAGGGAGAGGCAGAGGG - Intergenic
1049632428 8:143665791-143665813 GGGGACAAGGGACAGGAAGAAGG + Intergenic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1049698753 8:143996974-143996996 GGGGGCAGCGGGAAGGGGGAGGG + Intronic
1049769368 8:144372820-144372842 GGAGCCATGTGGGAGGAGGAGGG + Intergenic
1049803131 8:144527317-144527339 GGGGCCAAGGGAAAGGCGGGAGG - Exonic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050092721 9:2031711-2031733 GGGGCCAAGGAGAAGCAGGATGG - Intronic
1050388542 9:5113564-5113586 GGGATCAAGGGGAAGATGGATGG - Intronic
1050657509 9:7845152-7845174 GGGGCCTAGGGGAAGGTGTTTGG - Intronic
1050743600 9:8850880-8850902 TGGGCCAGGAGGAAGGAAGACGG + Intronic
1050985637 9:12078657-12078679 GGGGGTGGGGGGAAGGAGGAGGG - Intergenic
1051191634 9:14518926-14518948 GGGGGCTATTGGAAGGAGGAAGG + Intergenic
1052323424 9:27192669-27192691 GGGAGGAAGGGGAAAGAGGAAGG + Intronic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1052356675 9:27512049-27512071 GGAGCAAAGGGGCAGGAGCATGG - Intronic
1052947344 9:34179023-34179045 GGCGGTGAGGGGAAGGAGGAGGG + Exonic
1052998406 9:34564135-34564157 GAGGCCCCAGGGAAGGAGGAAGG - Intronic
1053005028 9:34598789-34598811 GGGGCCAAGGGGACGAAGCTAGG + Intergenic
1053117751 9:35520417-35520439 GGGGCCAGGGTGGAGGAGGTTGG - Intronic
1053124055 9:35565245-35565267 GCGGTCATGGGGAAGGAGCATGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053233815 9:36434317-36434339 GGGGGATGGGGGAAGGAGGAGGG + Intronic
1053449679 9:38182569-38182591 GGGGCCAAGAGGAAGGTGTTTGG - Intergenic
1053450690 9:38191985-38192007 GGGGAGAAGGGAAAGGAGGCTGG - Intergenic
1053677460 9:40448767-40448789 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1053927210 9:43074921-43074943 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1054286261 9:63176145-63176167 AGGGCCAAGGGGAAGAAAGATGG + Intergenic
1054290532 9:63284294-63284316 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1054388554 9:64588835-64588857 AGGGCCAAGGGGAAGAAAGATGG - Intergenic
1054507162 9:65927528-65927550 AGGGCCAAGGGGAAGAAAGATGG + Intergenic
1054734927 9:68741507-68741529 GGGGTCAAGGTGGAGGATGAGGG + Intronic
1055053701 9:72004413-72004435 GGGCTCAAGGGGAAAGAGGAGGG + Intergenic
1055091029 9:72364939-72364961 GGGGCCGAGGAGGAGGTGGAGGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1056489744 9:87093822-87093844 GGGGCCTATTGGAAGGTGGAGGG - Intergenic
1056539218 9:87556993-87557015 GAGGCCAAGGGGAAAGCCGAAGG - Intronic
1056591592 9:87969513-87969535 GAGGGCAAGGGGATGGATGAAGG - Intronic
1056628840 9:88276046-88276068 GGGGCAGAGGGGAAGAGGGAAGG - Intergenic
1056903858 9:90627512-90627534 GGGGCTAAGGGAATGGAAGAAGG + Intronic
1056921870 9:90797973-90797995 TAGGCCAAAGGGAAGTAGGATGG + Intergenic
1056965519 9:91160747-91160769 GGGGGGAAGGGGAGGAAGGATGG - Intergenic
1057082953 9:92186679-92186701 GAGGCAGAGGGGAAGAAGGAAGG - Intergenic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057182576 9:93037993-93038015 GGGAGAAAGGGGAGGGAGGATGG - Intergenic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057892695 9:98881345-98881367 GGGGGCAAGGGGTGGGAGGAAGG - Intergenic
1058129193 9:101230491-101230513 GCTCCCAAGGGGAAGGAGAAAGG - Intronic
1058377095 9:104335466-104335488 GGGGAGAAGGGGATGGAGAAAGG - Intergenic
1058618790 9:106862525-106862547 GAGGCAAAGGAGAAGGAGAAGGG - Intergenic
1058625600 9:106929954-106929976 GGAGTCAAAGGGAAGGAGGGAGG - Intronic
1058665767 9:107313945-107313967 GGGAAGAAAGGGAAGGAGGAAGG - Intronic
1058768927 9:108211618-108211640 AGCACCAAGGGGAAGGAGGTTGG - Intergenic
1058961166 9:109994104-109994126 GCAGCTAAGGGGAGGGAGGACGG + Intronic
1059329409 9:113525435-113525457 GGGGCACAGGGGAAGCAGGCAGG - Intronic
1059458725 9:114416087-114416109 GGGGACAAGAGGAGGGAAGAAGG + Intronic
1059484897 9:114619020-114619042 GGGGCCCACGGGAATGTGGAGGG + Intronic
1059652615 9:116329199-116329221 GGTGCCAAGAGTAAGAAGGATGG + Intronic
1059653002 9:116333058-116333080 AGGGCCAAGGGGGAGGACAAGGG + Intronic
1059668207 9:116469440-116469462 GGGGCACAGGGGAATGAGGCAGG - Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059998748 9:119939306-119939328 GGAGACATGAGGAAGGAGGAAGG + Intergenic
1060046679 9:120347027-120347049 GGGGCCTATGGGAGGGTGGAGGG - Intergenic
1060069929 9:120537363-120537385 GAGGGCAAGGGCAGGGAGGAGGG - Intronic
1060190322 9:121588535-121588557 GGGGGAAAGGGGAAGGGTGAAGG + Intronic
1060209488 9:121701000-121701022 GGGGCCCGGTGGAGGGAGGAAGG - Intronic
1060368377 9:123043634-123043656 GGGGGTGAGGGGAAGGAGGGTGG + Intronic
1060521786 9:124298206-124298228 GGCGCGAGGGGGAAGGAGGAAGG - Intronic
1060600019 9:124871044-124871066 GGGGCCCAGGTGGAGGAGAATGG + Intronic
1060670688 9:125466751-125466773 GGGACCCAGGGGAAGGAGGAAGG - Intronic
1060732331 9:126046662-126046684 GGGGCCCAGGGGAGAGAGGTTGG - Intergenic
1060952463 9:127612689-127612711 GGGACCGCGAGGAAGGAGGATGG - Intronic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1061042109 9:128146247-128146269 GGGGCCGAGGGGAGGCAGGTGGG + Intergenic
1061074835 9:128334726-128334748 GGGCCCAAGGAGCAGGAGGTGGG + Intergenic
1061086893 9:128404782-128404804 GGGACCAAGGGGAGGAGGGATGG + Intergenic
1061086964 9:128405106-128405128 TGTGGCCAGGGGAAGGAGGAGGG - Intergenic
1061090081 9:128421313-128421335 GGCCCCAAGAGGAAGGAGTAGGG - Intronic
1061251473 9:129428871-129428893 GGGTGGAAGGGGAAGGAGGGTGG - Intergenic
1061281195 9:129598357-129598379 GGGACCACGGGCAGGGAGGAAGG - Intergenic
1061537826 9:131260461-131260483 GGGGCTCAGGGGCAGGAGGAGGG - Exonic
1062050473 9:134444324-134444346 GGAGGGAAGGGGAAGGAGGGAGG - Intergenic
1062159514 9:135072410-135072432 GGGGCTAAGGGGAAGGAGGTTGG - Intergenic
1062194084 9:135263772-135263794 GGGGGCAGGGGGAGGGAGCAGGG - Intergenic
1062316418 9:135969306-135969328 GGGGCCAGGGGGCAGGAAGGTGG + Intergenic
1062318530 9:135979501-135979523 GGGGTCCAGGGGAAGGGGGTGGG - Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062588733 9:137263503-137263525 AGGGCCAGGGGGAAGGAGGGAGG - Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203472520 Un_GL000220v1:122467-122489 GGGGACAAGGGGGAGAGGGAAGG - Intergenic
1203363548 Un_KI270442v1:238053-238075 AGGGACAAGGGGAAGAGGGAAGG + Intergenic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185511528 X:668012-668034 GGGGGGAAGGGGAAGGAGAGGGG - Intergenic
1185550526 X:980193-980215 GGCTGCAAGGGGGAGGAGGAGGG + Intergenic
1186222486 X:7364722-7364744 GTTGCCAGGGGGAAGAAGGAGGG + Intergenic
1186324366 X:8462609-8462631 GGGGTGAAGGGGAAGGGGGGGGG + Intergenic
1186455887 X:9709524-9709546 GGGGCCCAGGGCAGGGTGGAGGG - Intronic
1186523628 X:10228210-10228232 GGGGAGGAGGGGATGGAGGATGG - Intronic
1186760606 X:12718199-12718221 GAGGCCGAAGGGAAGGAAGAAGG + Exonic
1186778936 X:12893583-12893605 GGGGTGGAGGGGAAGGAGGAAGG + Intergenic
1187274898 X:17808622-17808644 GGGGCCGGGGGGGAAGAGGAGGG - Intronic
1187464349 X:19514790-19514812 GGGGACGAGGGGGAGGGGGACGG + Intronic
1187654736 X:21458760-21458782 GGGGCCTATTGGAAGGTGGAGGG - Intronic
1188038890 X:25349294-25349316 GGTGCCAAGGGGCAGGGGGAGGG - Intergenic
1188146544 X:26620840-26620862 GGGGAAAAGGGTGAGGAGGATGG + Intergenic
1188726801 X:33594589-33594611 GAGGCCAAGGCCAAGGCGGACGG + Intergenic
1189197798 X:39166525-39166547 GGGGTCGAGGGGATGGTGGAAGG + Intergenic
1189289710 X:39876494-39876516 GGGGGCAAGGAGAGGGAGAAGGG + Intergenic
1189301710 X:39957064-39957086 GGGGCCAAGGGGATGAAGGGAGG + Intergenic
1189376121 X:40467363-40467385 GGGGCACAGGGCAGGGAGGAGGG + Intergenic
1189534423 X:41922816-41922838 GGGGAAGAGGGGAAGGAGGGAGG + Intronic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1190074049 X:47302682-47302704 GGGGCGGAGGGGAAAGAGGGAGG - Intergenic
1190136589 X:47804477-47804499 GGGGCCCCGGAGGAGGAGGAGGG - Intergenic
1190225306 X:48540185-48540207 GGGGCTATGGGGCTGGAGGAGGG + Intronic
1190305118 X:49077613-49077635 TGGGCCAAAGGGCAGGATGAGGG + Intronic
1190320656 X:49177505-49177527 GGCTCCAAGTGGAAGGAGAATGG + Intronic
1190732959 X:53236595-53236617 GGGGACAGAGGGAGGGAGGAGGG - Intronic
1190734466 X:53246897-53246919 GGGGGTAAGGGGAAGGATGCAGG - Intronic
1191882901 X:65860197-65860219 GAGGCCAATGGGAAGGACCAAGG + Intergenic
1191932369 X:66388298-66388320 GGGGGAAGGGGGAAGGGGGAAGG - Intergenic
1192326050 X:70133353-70133375 GGGGTGAAGGGGGAAGAGGACGG + Intergenic
1192418157 X:71003143-71003165 GGGGTTAAGGGGCAGGGGGATGG + Intergenic
1192925419 X:75750217-75750239 GGAGGCATGGGGATGGAGGATGG - Intergenic
1193308702 X:79979750-79979772 GGGGCCTATGGGAGGGTGGAAGG - Intergenic
1194268720 X:91783329-91783351 GGAGCCAGGGGGAAGGGGCAGGG - Intronic
1194394392 X:93363330-93363352 GGGGCCTACGGGAAGGTGCAGGG + Intergenic
1194418513 X:93643280-93643302 GGGGCCAAGGAGAAGGAATTTGG + Intergenic
1194534684 X:95091687-95091709 GGGGTTAAGGGGAATGGGGAAGG + Intergenic
1195294623 X:103463689-103463711 GGGGCCAGGGGGTAGGAGTAGGG + Intergenic
1195429338 X:104770894-104770916 GGGGCCTATTGGAAGGTGGAAGG - Intronic
1195744521 X:108102982-108103004 GGGGAGTAGGGGGAGGAGGAGGG - Intronic
1195758855 X:108225045-108225067 GGGGGCGGGGGGAAGGGGGAAGG + Intronic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195887989 X:109660911-109660933 GGTTCCCAGGGGAAGGAGGGAGG + Intronic
1195917596 X:109951068-109951090 GGGGGCAAGGGGGAGTGGGATGG + Intergenic
1196180470 X:112684405-112684427 TGGGCTACGGGGAGGGAGGAGGG - Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1196798928 X:119524821-119524843 GGGGCCAGAGTGAGGGAGGAGGG - Intergenic
1196898418 X:120360268-120360290 AGGGACAAGGGGAGGGAGAAAGG - Intergenic
1197892185 X:131278800-131278822 GGGTTCAAGGGCAAGGAGGAGGG - Intronic
1198960287 X:142175420-142175442 TGGGAAAAGGGGCAGGAGGAGGG - Intergenic
1198997151 X:142586048-142586070 GGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1199399345 X:147378196-147378218 AGGGCCAATGGGAATGAGTAGGG - Intergenic
1199557018 X:149120610-149120632 GGGACCTGGAGGAAGGAGGAGGG - Intergenic
1199587564 X:149432281-149432303 GGGGCAAAGGGAAAGGAATAGGG - Intergenic
1199878446 X:151953892-151953914 GGGGTCAAAGAGAAGGAAGAGGG + Exonic
1199996980 X:153031646-153031668 GGGGCCCTCGGGAAGGAGGGAGG + Intergenic
1200044807 X:153395822-153395844 GGGGCCCTCGGGAAGGAGGGAGG - Intergenic
1200076734 X:153554876-153554898 GGGGCCATGGGGAAGGAACTGGG + Intronic
1200090236 X:153632651-153632673 GGGGGACAGGGGCAGGAGGAGGG - Intergenic
1200143516 X:153913676-153913698 GGGGCCAAAGGGAGGGGGGCAGG + Intronic
1200154966 X:153970443-153970465 GGGGAGAAGGGGGAGGGGGACGG + Intronic
1200206095 X:154317462-154317484 AGGGCCAAGTGGTAGGAGCATGG + Intronic
1200213349 X:154356644-154356666 GGGGGATAGGGGAAGGGGGAAGG + Intronic
1200585922 Y:5004245-5004267 GGAGCCAGGGGGAAGGGGCAGGG - Intronic
1200604868 Y:5250601-5250623 GGGGCCTACTGGAAGGTGGAGGG + Intronic
1200701676 Y:6407879-6407901 GGAGCCAAGGGGGAGTGGGATGG - Intergenic
1201032435 Y:9756819-9756841 GGAGCCAAGGGGGAGTGGGATGG + Intergenic
1201284149 Y:12364707-12364729 GGGGCCAAGGCCAAGGTGGGTGG - Intergenic
1201300241 Y:12498750-12498772 GGGAGGAGGGGGAAGGAGGAGGG - Intergenic
1201563710 Y:15344679-15344701 GTGGCCAAGAGGAAGCAGCAGGG + Intergenic
1201592122 Y:15627107-15627129 GGTGCCAGGGGGAAGAAGGAGGG + Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1202164753 Y:21975490-21975512 AGTGCAAAGGGGAACGAGGAAGG - Intergenic
1202226603 Y:22610884-22610906 AGTGCAAAGGGGAACGAGGAAGG + Intergenic
1202316516 Y:23584778-23584800 AGTGCAAAGGGGAACGAGGAAGG - Intergenic
1202554248 Y:26085280-26085302 AGTGCAAAGGGGAACGAGGAAGG + Intergenic