ID: 1028875919 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:95823323-95823345 |
Sequence | CAGTCCAATGCCTGGCTGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1028875914_1028875919 | 10 | Left | 1028875914 | 7:95823290-95823312 | CCCTGCTGTGACTTCCAAAGGAT | 0: 1 1: 0 2: 1 3: 16 4: 148 |
||
Right | 1028875919 | 7:95823323-95823345 | CAGTCCAATGCCTGGCTGGCTGG | No data | ||||
1028875916_1028875919 | -4 | Left | 1028875916 | 7:95823304-95823326 | CCAAAGGATGATGAAACTGCAGT | 0: 1 1: 0 2: 0 3: 32 4: 431 |
||
Right | 1028875919 | 7:95823323-95823345 | CAGTCCAATGCCTGGCTGGCTGG | No data | ||||
1028875915_1028875919 | 9 | Left | 1028875915 | 7:95823291-95823313 | CCTGCTGTGACTTCCAAAGGATG | 0: 1 1: 0 2: 2 3: 14 4: 121 |
||
Right | 1028875919 | 7:95823323-95823345 | CAGTCCAATGCCTGGCTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1028875919 | Original CRISPR | CAGTCCAATGCCTGGCTGGC TGG | Intronic | ||
No off target data available for this crispr |