ID: 1028875919

View in Genome Browser
Species Human (GRCh38)
Location 7:95823323-95823345
Sequence CAGTCCAATGCCTGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028875914_1028875919 10 Left 1028875914 7:95823290-95823312 CCCTGCTGTGACTTCCAAAGGAT 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1028875919 7:95823323-95823345 CAGTCCAATGCCTGGCTGGCTGG No data
1028875916_1028875919 -4 Left 1028875916 7:95823304-95823326 CCAAAGGATGATGAAACTGCAGT 0: 1
1: 0
2: 0
3: 32
4: 431
Right 1028875919 7:95823323-95823345 CAGTCCAATGCCTGGCTGGCTGG No data
1028875915_1028875919 9 Left 1028875915 7:95823291-95823313 CCTGCTGTGACTTCCAAAGGATG 0: 1
1: 0
2: 2
3: 14
4: 121
Right 1028875919 7:95823323-95823345 CAGTCCAATGCCTGGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028875919 Original CRISPR CAGTCCAATGCCTGGCTGGC TGG Intronic
No off target data available for this crispr