ID: 1028876082

View in Genome Browser
Species Human (GRCh38)
Location 7:95824834-95824856
Sequence CGGTTTACACAGAAGGAATT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028876074_1028876082 18 Left 1028876074 7:95824793-95824815 CCTCTCTAAGATACTGCCATCTG 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1028876078_1028876082 2 Left 1028876078 7:95824809-95824831 CCATCTGCGGGGAAGCTGTCCTG 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1028876073_1028876082 29 Left 1028876073 7:95824782-95824804 CCAGGAGTGCTCCTCTCTAAGAT 0: 1
1: 0
2: 2
3: 19
4: 220
Right 1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028876082 Original CRISPR CGGTTTACACAGAAGGAATT CGG Intronic
901729564 1:11269475-11269497 AGTTTTACACATAAGGAAATAGG - Intergenic
907566730 1:55442470-55442492 CTGTTTTCACTGAAGGAAATAGG - Intergenic
907938431 1:59063873-59063895 CTGCTGACAAAGAAGGAATTTGG + Intergenic
908564571 1:65341249-65341271 TGGTTTCCAAAGAAGGAACTAGG - Intronic
913141298 1:115943840-115943862 CGTTTTACAGATAAGGAAGTCGG + Intergenic
914412635 1:147446054-147446076 GGGTTTACACAGAATGAATGTGG - Intergenic
915847459 1:159282367-159282389 AGGATTCCACAGAAGGAAGTTGG - Intergenic
917822237 1:178775261-178775283 GGGTTTACACAGAGGTAATGTGG + Intronic
919111817 1:193229502-193229524 CGGTTTACAAACCAGGAAGTGGG + Intronic
919221402 1:194634009-194634031 CAGTCTACACATAAGGAATGAGG + Intergenic
920098823 1:203503794-203503816 CCGTTTAAAGATAAGGAATTGGG - Intronic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
1063111129 10:3038344-3038366 CTATTTAAACAGAAGGTATTTGG - Intergenic
1068013038 10:51478374-51478396 AGCTTTACCCAGAAGGAATGTGG - Intronic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1069777962 10:70937807-70937829 CAGTTTACAGATAAGGAAATAGG - Intergenic
1069809326 10:71146801-71146823 CTGTTTAGACAGCAGAAATTGGG - Intergenic
1077929599 11:6717239-6717261 CTGTGGACACAGAAGGACTTCGG - Intergenic
1078001254 11:7497992-7498014 AGGTTGACACAGTATGAATTGGG + Intronic
1079765139 11:24382649-24382671 TACTTTACACAGAAGGAGTTGGG - Intergenic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1082011396 11:47452156-47452178 TGGTGAACAGAGAAGGAATTAGG - Intergenic
1085393619 11:76194997-76195019 TGGTATATTCAGAAGGAATTGGG - Intronic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1089269922 11:117295065-117295087 CACTATACAGAGAAGGAATTAGG - Intronic
1096452138 12:51752294-51752316 TGGTTAACACCTAAGGAATTAGG - Intronic
1096480713 12:51939045-51939067 CTGGTTACACAGAATGAGTTGGG - Intergenic
1099284330 12:80697450-80697472 GGGTTGACACAGAAGGCTTTAGG - Intergenic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1111190525 13:84800876-84800898 CGGTGTACACAGAAGATATTGGG - Intergenic
1114173052 14:20293836-20293858 AGGTTTACAGAGAAAGATTTAGG + Intronic
1115270867 14:31550759-31550781 TTGTTTACTCAGAAGGACTTTGG + Intronic
1118048336 14:61997282-61997304 TGATATACACAGAAGGGATTTGG + Intronic
1120155063 14:81084392-81084414 AGGTTTAAAAAGAAGGAATGTGG - Intronic
1123440109 15:20284475-20284497 CCCTTTACACAGAAAGAAATTGG - Intergenic
1127853820 15:62938604-62938626 CTCTGTACACTGAAGGAATTGGG - Intergenic
1129003703 15:72354828-72354850 GGGTTTACTGAGAAGGCATTTGG - Intronic
1129937837 15:79465602-79465624 CGGCTCAGACAGAAGGAAATTGG - Intronic
1133645743 16:7762961-7762983 AGTTTTACAAAGAAAGAATTTGG + Intergenic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1136845064 16:33569960-33569982 CCCTTTACACAGAAAGAAATTGG + Intergenic
1137008126 16:35297352-35297374 CACTTTCCACAAAAGGAATTGGG + Intergenic
1139274792 16:65717367-65717389 TGGTTGACACAGAAGCAATTGGG + Intergenic
1203106772 16_KI270728v1_random:1418613-1418635 CCCTTTACACAGAAAGAAATTGG + Intergenic
1203155232 16_KI270728v1_random:1870258-1870280 CCCTTTACACAGAAAGAAATTGG + Intergenic
1142797449 17:2319652-2319674 CGGTAGACACAGAAGCAGTTGGG - Intronic
1146463916 17:33070689-33070711 GGGTTCACACAAAAGGAATGAGG - Intronic
1149158362 17:53661499-53661521 CCTTATACACAGAAGAAATTTGG + Intergenic
1153720407 18:7896103-7896125 AGGTCAACACAGAAGCAATTAGG - Intronic
1155711958 18:28892237-28892259 CGCCTTACATAGAAGGAAATTGG + Intergenic
1160348180 18:78151931-78151953 AGGTTTCCAAAGAAGGGATTCGG + Intergenic
1161462442 19:4406367-4406389 CGTTTTATGCAGAAGGATTTGGG - Intronic
1162847840 19:13407415-13407437 CATTTTACAGAGAAGGAAATAGG - Intronic
1165850662 19:38848749-38848771 CGATTTACAAAGGAGGAAATGGG - Intronic
1166493839 19:43283805-43283827 CAGTGAACACAGAAGAAATTTGG - Intergenic
926000265 2:9325447-9325469 TGTTTTACAAAGAATGAATTTGG + Intronic
933799450 2:85949147-85949169 TGGTCTACAGGGAAGGAATTGGG + Intergenic
940237454 2:151526663-151526685 GAGTTCACACAGCAGGAATTAGG - Intronic
940503093 2:154519444-154519466 AGATTTACACAGCTGGAATTAGG - Intergenic
941427386 2:165365991-165366013 TGAGTTACACAGAAGGAAATAGG - Intronic
941725891 2:168859819-168859841 TGGTGTACACAGAATGTATTCGG - Intronic
944516334 2:200515309-200515331 TGGTTTTCAGAGAATGAATTGGG - Intronic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
945714631 2:213343005-213343027 TGGTGTACACAGAAGGAAGGAGG + Intronic
948573087 2:238929765-238929787 CTGTTTACACAGAAGGGCTGTGG - Intergenic
1172942063 20:38660848-38660870 GGGTTTCCACAGAAGTCATTGGG + Intergenic
1177804714 21:25863307-25863329 GGTTTAAAACAGAAGGAATTTGG - Intergenic
1182213324 22:28694872-28694894 CCCTTTACACAGAAAGAAATTGG + Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183010709 22:34944379-34944401 CTGTTTACACAGCAGGGGTTGGG - Intergenic
1183226251 22:36551886-36551908 AGGTTCACACAGCAGGAATATGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950313276 3:11977700-11977722 AGGTGTAGAGAGAAGGAATTAGG + Intergenic
952189338 3:31005840-31005862 GGATTTAAACAGAAGAAATTAGG - Intergenic
953350111 3:42209138-42209160 CGGGTTAGGGAGAAGGAATTGGG - Intronic
955194919 3:56796357-56796379 TGGTTTACACAGAAGGCTTGTGG + Intronic
957684295 3:83481007-83481029 AGGTTTAAACAGAAGAATTTTGG - Intergenic
959129062 3:102329593-102329615 AAGTTTAGACAGTAGGAATTTGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962426892 3:135278075-135278097 CAGTTTCCACATAAGGAATAGGG + Intergenic
966702388 3:182869459-182869481 CAGTTTTCACAAAAGGAATGTGG - Intronic
972692168 4:41410081-41410103 CAGTTTACATAAAAGGATTTGGG - Intronic
974180332 4:58376275-58376297 CTGGTTTCACAGAATGAATTAGG + Intergenic
978589182 4:110305480-110305502 CAGCTTACACTGAAGGAATACGG + Intergenic
979201963 4:117989169-117989191 AGGTTTACAACAAAGGAATTTGG + Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
981759756 4:148181382-148181404 CATTTTACAGATAAGGAATTTGG - Intronic
982057441 4:151566557-151566579 TGGTTTTCACAAAAGCAATTAGG + Intronic
984425441 4:179579372-179579394 GGGCTGACAGAGAAGGAATTGGG + Intergenic
988385022 5:30551846-30551868 TGGTTTACAGAGAAGGAAAGTGG + Intergenic
988920016 5:35932499-35932521 AGATTTACATAGAAGGAATTGGG - Intronic
990019774 5:51111024-51111046 AGGTTTTCAGAGAATGAATTGGG - Intergenic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993292098 5:86086925-86086947 CGATTTTAAAAGAAGGAATTTGG + Intergenic
996615114 5:125432179-125432201 CATTTTAAGCAGAAGGAATTGGG - Intergenic
999571851 5:152927556-152927578 CAGGTGACACAGAAGGAGTTAGG + Intergenic
1002337682 5:178491536-178491558 TGGTTTACACAGAAGCTTTTGGG - Intronic
1004870486 6:19899328-19899350 CAGTTTACTCAAAAGAAATTTGG - Intergenic
1005460321 6:26063019-26063041 CATTTTACAGAGAAGGAACTTGG - Intergenic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1012702655 6:102481196-102481218 AGTTTTACACAGAAGAGATTTGG - Intergenic
1021346138 7:19530870-19530892 ATGTTTACATAGAATGAATTTGG + Intergenic
1022574093 7:31481090-31481112 TGGTGTAGACAGAAGGAATGGGG - Intergenic
1022903666 7:34834997-34835019 AGGTTTACTGAGAAGGAATGTGG - Intronic
1023251037 7:38261447-38261469 CTTTTTACACAGAAGGGCTTGGG - Intergenic
1027517773 7:79164021-79164043 CGTTTTAAACAGCAGCAATTTGG - Intronic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1034985177 7:155508488-155508510 AGGTTTCCACATAAGGAATCAGG - Intronic
1035651650 8:1270237-1270259 CCGTATACACAGAAGGGACTTGG + Intergenic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1036621382 8:10426297-10426319 TGGATTCTACAGAAGGAATTCGG + Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1041370383 8:57153405-57153427 GGGGTTACAGAGAAGTAATTAGG + Intergenic
1044430296 8:92101194-92101216 CAGTTCACACAGAAGGTATAAGG + Intronic
1051661596 9:19432036-19432058 CGTTTTACAGATAAGGAAATGGG + Intronic
1051922831 9:22287763-22287785 AGGTTTTCATACAAGGAATTCGG - Intergenic
1052601776 9:30642274-30642296 CTGTTTCCACACAAGAAATTTGG - Intergenic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1057974748 9:99593534-99593556 CTGTGAACACAGAAAGAATTAGG + Intergenic
1186418497 X:9404529-9404551 CTGATCACACAGAAGGCATTTGG + Intergenic
1187413604 X:19072823-19072845 CGGTTTATGCAGAAGGCAGTAGG - Intronic
1188836551 X:34963602-34963624 CTGTTTACTGATAAGGAATTAGG - Intergenic
1189732369 X:44034525-44034547 TGTTTTACACTGAAGGAATCTGG + Intergenic
1194897576 X:99464059-99464081 CAGTTAACCCAGAAGGAATGTGG - Intergenic
1199013342 X:142782321-142782343 CTGTTTACTCAGAAGCAATGAGG - Intergenic