ID: 1028876302

View in Genome Browser
Species Human (GRCh38)
Location 7:95827110-95827132
Sequence CAGAGTAAACAAAGGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028876296_1028876302 12 Left 1028876296 7:95827075-95827097 CCCAAGAGATGTTGATGCTACTG 0: 1
1: 0
2: 27
3: 172
4: 684
Right 1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG 0: 1
1: 0
2: 4
3: 30
4: 255
1028876295_1028876302 22 Left 1028876295 7:95827065-95827087 CCAACAAACTCCCAAGAGATGTT 0: 1
1: 0
2: 3
3: 31
4: 205
Right 1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG 0: 1
1: 0
2: 4
3: 30
4: 255
1028876297_1028876302 11 Left 1028876297 7:95827076-95827098 CCAAGAGATGTTGATGCTACTGC 0: 1
1: 0
2: 3
3: 51
4: 383
Right 1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG 0: 1
1: 0
2: 4
3: 30
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028876302 Original CRISPR CAGAGTAAACAAAGGGATGC AGG Intronic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
901221250 1:7585259-7585281 CAGAGTAAAGGAAGGGGTACGGG + Intronic
902319241 1:15648747-15648769 CAGAGTAAACACCTAGATGCAGG + Intronic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
904538639 1:31217837-31217859 CTGTATAAACAAAGGGCTGCAGG + Intronic
904821005 1:33244316-33244338 CACAGACAACAAAGGGATCCTGG - Intergenic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
905346352 1:37313575-37313597 CAAGGCAAACAAAGAGATGCTGG - Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906587006 1:46987160-46987182 CAAAATAAATAAAGGGATGGAGG + Intergenic
908135246 1:61125526-61125548 CAGAGCACACAAAGAGATCCTGG + Intronic
908367206 1:63437293-63437315 CTGAGTAAACAATGGGATTAAGG - Exonic
911240689 1:95462601-95462623 CAGAGTAAAGAAAGGCAGACAGG + Intergenic
912574355 1:110651901-110651923 CAGAGTAAATTAAGAGATGCAGG - Intergenic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913273490 1:117116854-117116876 AAGAGAAAACAAAGGGACCCAGG - Intronic
913497829 1:119444673-119444695 CTGAGTAAACAATGGGTTGTGGG - Intergenic
916266346 1:162893273-162893295 CAGAGGAGAGAAAGGGATGAAGG - Intergenic
917560361 1:176146233-176146255 CAGATTAAACAAAAGGGTGTTGG - Intronic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
921119754 1:212126399-212126421 CAGAGGTAACAGAGGCATGCAGG + Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
921930434 1:220749835-220749857 TGGAGTGAACACAGGGATGCAGG - Intronic
922088188 1:222370673-222370695 CAGAGGAGAGAAAGGGCTGCAGG + Intergenic
922852983 1:228749853-228749875 CAGAGTAAGCAAAGGAACCCAGG - Intergenic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
1062915020 10:1238067-1238089 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915058 10:1238184-1238206 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915117 10:1238373-1238395 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915223 10:1238707-1238729 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915282 10:1238896-1238918 GGGAGTAAACACCGGGATGCAGG - Intronic
1063258351 10:4354297-4354319 CAGTGCAAACAAAGGGAATCTGG + Intergenic
1064966750 10:21021880-21021902 CAGAAGAAACGAAGGGATGGAGG + Intronic
1065037595 10:21655793-21655815 CAGAGTAAACAGTGGGTTTCAGG + Intronic
1065063047 10:21927954-21927976 CAGAGTAAAGGAAGGGAAGGAGG + Intronic
1065170184 10:23019212-23019234 CAGAGTAAAAAGTGGGGTGCAGG + Intronic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1075282456 10:121151655-121151677 CAGAGTAAACAAGGGGAGAATGG - Intergenic
1075836287 10:125455785-125455807 CAGAGTAAACATCGCGATACAGG + Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1078493211 11:11788522-11788544 CAGAGTAACCTAAGTGAAGCAGG - Intergenic
1079379291 11:19923015-19923037 CAGAGTAAATAAAAGAAAGCAGG + Intronic
1081779208 11:45698495-45698517 CAGAGAAGAAAAAGGGAGGCAGG + Intergenic
1082161310 11:48891963-48891985 CAGAGTAAGCAAATGAATTCAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083852504 11:65376544-65376566 CAGAGTGTACCAGGGGATGCTGG - Exonic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1086095986 11:83050284-83050306 ATGAGTAAATAAAGGGATTCAGG - Intronic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1088830300 11:113531156-113531178 CAGAGGAGAGAAAGGGATGTTGG - Intergenic
1089704277 11:120266220-120266242 CAGAGGAAAGAAAGGAATCCAGG - Intronic
1089881160 11:121775109-121775131 CAGAGTAAGCAAAGCGGAGCTGG + Intergenic
1090219606 11:125007527-125007549 CACAGTAAACATGGGGATACAGG + Intronic
1090691875 11:129192011-129192033 CAGAGAAGAAAAAGGGGTGCGGG + Intronic
1091131396 11:133150017-133150039 CAGTGTTAATCAAGGGATGCTGG - Intronic
1091549075 12:1524221-1524243 AAGAGTAAACAAAGCTATGATGG - Intergenic
1092740495 12:11624065-11624087 CAGACTAAACAAAGGGAAAGGGG - Intergenic
1092759921 12:11800559-11800581 CAGAGTAAAAGAAGGGATGCGGG - Intronic
1093439951 12:19183310-19183332 CAGAGGAAACTAAGGTTTGCTGG - Intronic
1093763352 12:22935297-22935319 CAGAGAAAAGAAAGGGGCGCTGG - Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095179746 12:39133918-39133940 CAAAGCAAACCAAGAGATGCAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1098418653 12:70266765-70266787 AAAAGTAAACAAAGAGAAGCTGG - Intronic
1099988504 12:89697760-89697782 CAGAGTAGAAAATGGGATGGGGG - Intronic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1104947470 12:132422570-132422592 CACAGAAAACAAGGGGATGAAGG + Intergenic
1105471767 13:20701551-20701573 CTGAGTAAACCAGGGGATGAGGG + Intergenic
1105783324 13:23723290-23723312 AAAAGAAAACAAAGGGATGGTGG - Intergenic
1106954202 13:34917651-34917673 CTGTGAAAACAAAGGGCTGCAGG - Intergenic
1108088041 13:46816663-46816685 CAGAGTGAACAATGTGAGGCAGG - Intergenic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1109235999 13:59821263-59821285 CAGAGTAAACAAGCTCATGCAGG + Intronic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109683367 13:65783097-65783119 AAAAATAAATAAAGGGATGCTGG - Intergenic
1110833349 13:80056867-80056889 CAAGGTAAACATGGGGATGCAGG - Intergenic
1111806597 13:93045843-93045865 CAGAATAAAGAATGGGATGAGGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114221140 14:20698098-20698120 CAGATTAAAGAAAGGAATCCAGG - Intronic
1114708940 14:24757479-24757501 CAGAGAAAAGAAAGGGATAGAGG + Intergenic
1114737734 14:25059889-25059911 AAGAGTAGAAAAAGGGATGCTGG + Intergenic
1117282075 14:54251362-54251384 CAGAGAGAAGAAAGGGATGAGGG - Intergenic
1118503444 14:66385895-66385917 CTGCCTATACAAAGGGATGCGGG - Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1124139562 15:27065221-27065243 CTAAGTGAACAAATGGATGCAGG + Intronic
1124341687 15:28894091-28894113 TAGTGGAAACAAAGGGGTGCGGG + Intronic
1124413554 15:29456429-29456451 CACAGTCACCAAAGGGATGGGGG + Intronic
1124965486 15:34429876-34429898 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1124982111 15:34576083-34576105 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1128076569 15:64830174-64830196 CAGACTAAACCAAGGAAGGCAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129762213 15:78136341-78136363 CAGGTTAAACAAGGGGTTGCAGG - Intronic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1132190232 15:99848859-99848881 CAGAGTATAGAAAGTGAAGCAGG - Intergenic
1133156139 16:3877699-3877721 CACATTAAACAAGGGGCTGCTGG - Intronic
1133559367 16:6936224-6936246 TAGAATAAATTAAGGGATGCTGG + Intronic
1133590235 16:7235475-7235497 CATCGTAAACAAGGAGATGCTGG + Intronic
1134157386 16:11854566-11854588 TAGAATACACAAAGGGAAGCAGG - Intergenic
1134569968 16:15282676-15282698 CAGAGTCAACAAATGGAACCAGG + Intergenic
1134732410 16:16473374-16473396 CAGAGTCAACAAATGGAACCAGG - Intergenic
1134935028 16:18238590-18238612 CAGAGTCAACAAATGGAACCAGG + Intergenic
1138875480 16:60943409-60943431 CAGAGGAAAAAAATGGAGGCGGG + Intergenic
1139958292 16:70703711-70703733 CAGAGAAACCAAAGAGAAGCTGG - Intronic
1144795304 17:17887333-17887355 CAGAGGAAAAAATGGGGTGCAGG + Intronic
1146610432 17:34300057-34300079 CACTGTAAACAAAGGCATGTGGG + Intergenic
1146920349 17:36705871-36705893 GGGAGTATACAAAGGGAAGCTGG - Intergenic
1147756669 17:42773151-42773173 TAGAGGAAACAAAGGTAGGCTGG + Intergenic
1149188104 17:54026108-54026130 CAGAGTAAAGACAGGAATCCTGG + Intergenic
1150498764 17:65630078-65630100 CAGATTAAAGAAAGGTAGGCCGG + Intronic
1150707055 17:67496522-67496544 CATAGTAAACACGGGGAGGCTGG - Intronic
1155719742 18:28996212-28996234 CAGAGTAGAAAGATGGATGCTGG + Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1158038374 18:53062932-53062954 TAAAGTAAAGAAAGGGAAGCTGG - Intronic
1158399579 18:57109833-57109855 CAGAGGAAATAATGGGGTGCTGG - Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1160037023 18:75310798-75310820 CAAAGAAAACAAAGAGGTGCAGG - Intergenic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1165185757 19:34019606-34019628 CAGTAAAAACAAAGGGATGGAGG - Intergenic
1166114212 19:40642900-40642922 AAGAGTTAACAAAGGCATCCAGG - Intergenic
1167247080 19:48380034-48380056 CAGACTATTCAAAGAGATGCCGG + Intergenic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
925030184 2:644379-644401 TAGAGTAAATGAAGGGATGGAGG + Intergenic
925030194 2:644457-644479 TAGAGTAAATGAAGGGATGGAGG + Intergenic
925378293 2:3404738-3404760 TTGAGTAAATAAAGGGATGAGGG + Intronic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
927427021 2:22992624-22992646 TAGACTAAACAAAGAGACGCAGG - Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
932880210 2:75494320-75494342 TGGGGTAAACACAGGGATGCTGG + Intronic
934589944 2:95539323-95539345 CAGAGTAAACAAATGAATTCAGG + Intergenic
934612809 2:95753403-95753425 CAGAGAGAAGAAAGGGATGTGGG + Intergenic
935048779 2:99506085-99506107 CAGAGTGAACCAAGGGGTGGTGG - Intergenic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
936058861 2:109281524-109281546 CAGAGCATGCAAAGGGATGAGGG + Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936479759 2:112875471-112875493 CATAGTGAACAACTGGATGCAGG + Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
939110744 2:138003848-138003870 CAGAGAAAAGAATGGGATCCAGG - Intronic
940834066 2:158500912-158500934 CAGAGTAAAAGCAGGGAGGCTGG - Intronic
942779193 2:179621214-179621236 CACAGGAAACAAAGGCATACTGG + Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
945952992 2:216057646-216057668 CAGAGTAAAAAATGGTGTGCAGG - Intronic
946652060 2:221903013-221903035 CAAAGTAAATAAAGGGAAGGAGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947820237 2:233064055-233064077 CAGATTGCACAAGGGGATGCCGG - Intronic
1168809411 20:694454-694476 CACAGTGAACAAGGGGGTGCAGG + Intergenic
1170071763 20:12376734-12376756 CAGAGTAAAGATAGTGATACCGG - Intergenic
1172420828 20:34816131-34816153 GAGAGTAACCAAAGGAATGATGG - Intronic
1172806386 20:37615029-37615051 CTGAGTTTACAATGGGATGCAGG - Intergenic
1174294626 20:49536879-49536901 CAGAGAAAACACACAGATGCTGG + Intronic
1174830037 20:53804139-53804161 CAGAGTAAATAATGTGAAGCAGG - Intergenic
1175457495 20:59126560-59126582 TAGAGGAGACAAAGGGAAGCAGG - Intergenic
1178257515 21:31067875-31067897 CAGAGTTCACAAAGGAATGTGGG - Intergenic
1181258486 22:21580398-21580420 AACAGAAAACAAAGAGATGCTGG - Intronic
1181778084 22:25174293-25174315 CAGAGAAGACAAACGGCTGCTGG - Exonic
1182145475 22:27994468-27994490 TACAGTAAACACTGGGATGCCGG + Intronic
1183231338 22:36584032-36584054 CTGAGTAAAGAAAGGGAACCAGG - Intronic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1185350083 22:50330858-50330880 GACACTAAACCAAGGGATGCAGG + Intergenic
950099232 3:10346949-10346971 GAGAGGAAACAAAGTGATGCTGG - Intronic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954991340 3:54843282-54843304 TAGAGTAAACATAGTGATGATGG + Intronic
955746691 3:62147814-62147836 GACAGTAAACAAAGGAATGCTGG + Intronic
956055576 3:65295140-65295162 CACAGTAAAGGAAGGGATGAGGG + Intergenic
956398450 3:68850547-68850569 AAAAGTAAAGAAACGGATGCCGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
962371926 3:134827951-134827973 AAGCATAAACAAAGAGATGCTGG - Intronic
962616778 3:137134585-137134607 CTGATTAAACAAAGGGAGCCGGG - Intergenic
962849155 3:139295006-139295028 GACAGTAAACACAGGGAAGCCGG - Intronic
962922129 3:139959738-139959760 TAGAGTAAAAAAAGGGGGGCGGG - Intronic
964005646 3:151824425-151824447 GAGAGTAAACAAAAGGTTTCTGG + Intronic
964599569 3:158482573-158482595 CAAATAAAACAAAGGGATGGAGG - Intronic
965664747 3:171081341-171081363 AAGAGACAACACAGGGATGCTGG - Intronic
965781321 3:172289205-172289227 CAGACAAAGCCAAGGGATGCAGG - Intronic
967075158 3:185995217-185995239 CAGTGTAAACAAAGGCATAGAGG + Intergenic
967363834 3:188663304-188663326 CAGACTCAAGAAAGGGATGGGGG + Intronic
967485592 3:190026636-190026658 CAGAGTAGCCCAAGGGCTGCTGG - Intronic
968442835 4:633243-633265 CAGATCCAATAAAGGGATGCTGG + Intronic
969074798 4:4569411-4569433 GAGAGAACAAAAAGGGATGCTGG - Intergenic
970073982 4:12196555-12196577 GAGAGAGGACAAAGGGATGCTGG + Intergenic
975819389 4:78254374-78254396 CAGTGTAAATAAAGGATTGCTGG - Intronic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979685273 4:123505191-123505213 CAAAGTAAAACAAGGGATGGAGG + Intergenic
979751184 4:124280852-124280874 AAGAGTAAACTTAGGGATGGAGG + Intergenic
980467530 4:133204585-133204607 GAGAGGAAACAAAGTGGTGCTGG + Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982694494 4:158583996-158584018 CAGAGTAAACGCTGGAATGCAGG - Intronic
983568603 4:169180550-169180572 CAGAGTAAACAAGGGGAGTATGG + Intronic
983568633 4:169180955-169180977 AAGAGAAAAGAAAGGGTTGCTGG - Intronic
983845959 4:172518114-172518136 TAGAGTCACCAAAGGGATCCTGG + Intronic
984105686 4:175542189-175542211 CAGTGTAAACCAAGGAATGTAGG + Intergenic
984237482 4:177177974-177177996 CAGGGTTAACAAAGGAATTCAGG - Intergenic
985140085 4:186831102-186831124 AAGAGCTAACACAGGGATGCAGG - Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986999404 5:13644340-13644362 CATAGTAAGAAAATGGATGCTGG + Intergenic
989439271 5:41451074-41451096 CAGAGGAAATAAATGGATTCTGG + Intronic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
990310153 5:54530064-54530086 CAAAGAAAACCAAGGGCTGCTGG - Intronic
990549948 5:56864817-56864839 CCGTGTTAACAAAGTGATGCGGG + Exonic
990986820 5:61648467-61648489 CAGAGTGAACAAAGGAAAGTAGG + Intronic
991460625 5:66854749-66854771 CAGACTAAAAAAAGGTATGAAGG + Intronic
992161837 5:74011904-74011926 CAGAGTGGAAAAAGGGAAGCTGG + Intergenic
992551692 5:77865872-77865894 CAGAGTGGACAAACGGAGGCTGG - Intronic
992967577 5:82018844-82018866 CAGAGTAGGAAAAGGGAAGCAGG - Intronic
995474776 5:112536838-112536860 CAGAGTCTACAAAGGGCTGCAGG + Intergenic
996754371 5:126920634-126920656 CAGAGTAAATAATGGGACCCAGG + Intronic
998883911 5:146674503-146674525 GACAGTACACAAAGGGATGTAGG - Intronic
999721785 5:154404019-154404041 CTGAGTGCACTAAGGGATGCTGG + Intronic
1000914591 5:167064896-167064918 GAGAGTAACGAAAGGGATGAAGG + Intergenic
1003145912 6:3510674-3510696 CTGAGAAAACAAAGTCATGCGGG - Intergenic
1006411779 6:33877987-33878009 CAGAATAAAGAAGGGGCTGCTGG + Intergenic
1006940250 6:37747363-37747385 GAGAGTTCAGAAAGGGATGCTGG + Intergenic
1007865795 6:44968765-44968787 CAGAGAAAAGAAAGTGATGTGGG - Intronic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1008008722 6:46440780-46440802 CAGAGTAAACAAAGTCTTCCTGG + Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1008902582 6:56638505-56638527 CAGAGGAAAAAAAATGATGCTGG - Intronic
1008917114 6:56800173-56800195 CCGAGTAGACAAAGGGAAGAAGG + Intronic
1009061338 6:58400814-58400836 CAGAGTAAACTAATGGCTCCAGG + Intergenic
1009323442 6:62319481-62319503 CAGAATAAAAAAGGTGATGCAGG - Intergenic
1010598459 6:77794122-77794144 GATAGTAAATAAAGGAATGCAGG + Intronic
1011385120 6:86788047-86788069 CAGTGTAAAGAAAGGCAAGCTGG + Intergenic
1012585695 6:100919427-100919449 CATAGTAAACAAGGGGATACAGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013868729 6:114729330-114729352 CAGAGTAATCAATGGAATGTTGG + Intergenic
1013870230 6:114749251-114749273 TTGAGTGATCAAAGGGATGCAGG + Intergenic
1018044847 6:159956695-159956717 CAGAGTTAATAAAGAGAAGCTGG + Intergenic
1018777611 6:167032012-167032034 CAGAGTTAACATAAGGATTCAGG - Intronic
1022828531 7:34041357-34041379 CAGAGTAGACAAGGGGAGACAGG - Intronic
1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG + Intergenic
1024408475 7:49010620-49010642 CAGAGTAAAGAAAGGGACACTGG + Intergenic
1024970133 7:55061511-55061533 CAGAGCAAAGAAATGCATGCAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030486080 7:110169624-110169646 CAGAGTAAATTAAGGGAAGAGGG - Intergenic
1030647055 7:112073331-112073353 GACAGTAAACATGGGGATGCAGG - Intronic
1033272183 7:139942322-139942344 CAGAATAAACAAAGTTAAGCAGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG + Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1035826990 8:2655457-2655479 TAGTAAAAACAAAGGGATGCAGG - Intergenic
1037329871 8:17733632-17733654 CAATGTCAAGAAAGGGATGCGGG - Intronic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1042283198 8:67077799-67077821 CAGTGGATACAAGGGGATGCCGG + Intronic
1043428968 8:80175931-80175953 GGTAGTAAACAAAGGGATGAAGG + Intronic
1045317704 8:101057701-101057723 CAGAGGAAGCAATGAGATGCAGG - Intergenic
1045910060 8:107396991-107397013 CAGAAAGAAGAAAGGGATGCTGG + Intronic
1048194442 8:132320788-132320810 AAGAGAAAACAAATGAATGCTGG + Intronic
1048516854 8:135119094-135119116 GACAGAAAACAAAGGGCTGCTGG - Intergenic
1049700189 8:144007359-144007381 CAGACTAATCAAAGGGATATTGG + Intronic
1050491109 9:6188733-6188755 CAGCATTAACAAAAGGATGCTGG + Intergenic
1050768220 9:9163020-9163042 CAGAGGAAAAAAAGAGAAGCTGG - Intronic
1052197549 9:25735978-25736000 CTTAGTAAAGCAAGGGATGCAGG + Intergenic
1055205145 9:73721054-73721076 CAGAAAAAAAAAATGGATGCAGG + Intergenic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1060141389 9:121213323-121213345 CAGAATAGACGAAGGGATACAGG - Intronic
1060997362 9:127882774-127882796 CGCAGGAAACAAATGGATGCAGG + Intergenic
1062209777 9:135357213-135357235 CAGAGAAAGCCAAGGGATCCAGG + Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1186891983 X:13968043-13968065 CAGAGTAAACACTGATATGCTGG - Intergenic
1187728815 X:22232652-22232674 CAAAATAAATAAAGGGATGGAGG - Intronic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1195660441 X:107372644-107372666 CAGATGAAACAAATGGTTGCAGG - Intergenic
1196250933 X:113459446-113459468 CAGAACAAAGAAAGGGATACAGG + Intergenic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1199154317 X:144528760-144528782 GAGATTTATCAAAGGGATGCAGG + Intergenic
1199905158 X:152220189-152220211 CAGATTAAGCAATGGGATTCAGG - Intronic
1201147285 Y:11072240-11072262 CAGAGGAGAGAAAGGCATGCCGG + Intergenic