ID: 1028878937

View in Genome Browser
Species Human (GRCh38)
Location 7:95857214-95857236
Sequence GCTATTGCTGCAACTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028878937_1028878941 -1 Left 1028878937 7:95857214-95857236 CCTCCTTTAGTTGCAGCAATAGC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1028878941 7:95857236-95857258 CTTGGATAAAGGTCTTCATTAGG 0: 1
1: 0
2: 1
3: 8
4: 139
1028878937_1028878942 6 Left 1028878937 7:95857214-95857236 CCTCCTTTAGTTGCAGCAATAGC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1028878942 7:95857243-95857265 AAAGGTCTTCATTAGGTAGTAGG 0: 1
1: 0
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028878937 Original CRISPR GCTATTGCTGCAACTAAAGG AGG (reversed) Intronic
900937339 1:5774747-5774769 GCTATTTTTGCCACGAAAGGAGG - Intergenic
910425238 1:87114764-87114786 GCTATGGCTGCAACTCAGTGCGG + Intronic
914244149 1:145873277-145873299 GCTTCTGCTTCAACTAAGGGAGG - Exonic
916600747 1:166290969-166290991 GCTATTACTGGAAGTAAAGATGG - Intergenic
917171465 1:172180614-172180636 GCTATTCCTGCAATAAAAGAAGG - Intronic
918119245 1:181523207-181523229 GCTAGTACTGCAAATAAAGGAGG + Intronic
918901663 1:190428984-190429006 ACTATTGCTGAAAATAATGGAGG + Intronic
1065585120 10:27210382-27210404 TCTATTGTTGTATCTAAAGGAGG + Intronic
1066667535 10:37800419-37800441 TCTTTTGCAGCAACAAAAGGTGG - Intronic
1067825801 10:49571976-49571998 GCTAGACCTGCATCTAAAGGTGG - Intergenic
1074471806 10:113734111-113734133 GTTATGGCTGCAAATAAACGAGG + Intergenic
1075442712 10:122492717-122492739 GCTGTTGCTGCCAGAAAAGGGGG - Intronic
1078044932 11:7905071-7905093 TCTATTTCTGCCACCAAAGGAGG + Intergenic
1083354388 11:62055201-62055223 TCTATTTCTGCCACTGAAGGAGG + Intergenic
1083379399 11:62252813-62252835 TCTATTTCTGCTACTGAAGGAGG - Intergenic
1096577956 12:52566342-52566364 GCTATTGCTGATAATGAAGGAGG + Exonic
1100042064 12:90331872-90331894 ATTATTGCTGTAACTGAAGGAGG - Intergenic
1100228479 12:92583118-92583140 GCTATTGTTGGAACAAAAGGAGG + Intergenic
1100641099 12:96483070-96483092 GCTATTTTTGCAAGTATAGGGGG - Intergenic
1103071949 12:117951730-117951752 ACTATTTCCTCAACTAAAGGAGG + Intronic
1115000124 14:28411804-28411826 TCTATTTCTGCTACCAAAGGAGG - Intergenic
1117779053 14:59213523-59213545 GCTATTCCTAAAACTAAAGGAGG + Intronic
1121413256 14:93762282-93762304 GCTACTGGTGCAATTAAAAGGGG - Intronic
1125623664 15:41087670-41087692 GATATTGCTGCAACTGAAGCAGG + Exonic
1126872235 15:53002143-53002165 GCTGTTGCCTCAATTAAAGGAGG + Intergenic
1128158142 15:65404732-65404754 GCTATTGCTGCAGCCAATAGAGG + Intronic
1129117202 15:73371036-73371058 GTCATTGCTGCACCTAAAGTTGG - Intergenic
1134806132 16:17127025-17127047 GCTATTGCAGCAGCTTAAGTGGG + Intronic
1144028424 17:11298865-11298887 GCTTTTGCAGCTACTCAAGGTGG + Intronic
1144344278 17:14336028-14336050 GGTATTTCTGCAACTAAACAAGG + Intronic
1146643473 17:34559300-34559322 GCTATTGCTACAACTAAGGAAGG + Intergenic
1147933536 17:43997799-43997821 GCTATTTCTTCAACTCAGGGTGG + Intronic
1151514694 17:74585481-74585503 TCTATTTCTGCTACTGAAGGAGG - Intronic
1151709293 17:75792312-75792334 GCTATGGTTGATACTAAAGGAGG + Intronic
1156246945 18:35309771-35309793 GCTAATGCTGAAACTCAAAGAGG + Intergenic
1157011019 18:43648914-43648936 TCTATTGCAGCAAATAAAGAGGG - Intergenic
1162595515 19:11625867-11625889 TCTATTTCTGCTACTGAAGGAGG + Intergenic
1164233850 19:23315107-23315129 GGTATTGCTGGACCTAAAGCAGG + Intronic
1164277041 19:23728583-23728605 GCAATTGATACAAATAAAGGTGG - Intergenic
1164651157 19:29891846-29891868 ACTTTTGCTGGAACTAAAAGAGG + Intergenic
1167826346 19:51977050-51977072 GATGTTTCTGCAACTGAAGGAGG - Intronic
1167876059 19:52413622-52413644 TCTATTTCTGCTACTGAAGGAGG + Intronic
1167876065 19:52413652-52413674 GATGTTGCTGCAACTGGAGGGGG + Intronic
1168552773 19:57311597-57311619 GTTTTTGCTGCCACTGAAGGAGG + Intergenic
927021508 2:19021794-19021816 GCTATTGCAGCAACTGGAGTTGG + Intergenic
928858215 2:35825779-35825801 GCAAGTGCTTCAAGTAAAGGTGG + Intergenic
929485775 2:42352775-42352797 GCTATTGCTGAAAGTAGAGGAGG - Intronic
929807674 2:45161289-45161311 GCTAATGTTGCAAATACAGGTGG - Intergenic
932039833 2:68287531-68287553 GCTATGGGTCCAACAAAAGGTGG + Intronic
933005961 2:76995350-76995372 GATATTGCTGTAACTATATGTGG + Intronic
937624888 2:124033294-124033316 GATATTTCTGCTTCTAAAGGTGG - Intronic
940311354 2:152282158-152282180 GATTTTGCTGCAAGCAAAGGTGG + Intergenic
946223049 2:218245676-218245698 GCCATTGCAGTGACTAAAGGAGG + Intronic
948606172 2:239137119-239137141 CCCATTTCTGGAACTAAAGGAGG + Intronic
1168905221 20:1397920-1397942 ACTATTTCTGCTACCAAAGGAGG - Intergenic
1171474996 20:25401805-25401827 TCTATTTCTGCTACTGAAGGAGG + Intergenic
1174595714 20:51681837-51681859 GCTCTTGCTGCATGAAAAGGAGG + Intronic
1176815401 21:13595913-13595935 GCTGCTCTTGCAACTAAAGGTGG + Intergenic
1177660208 21:24073070-24073092 GCATTTGCTGCAGCTAAAGGAGG + Intergenic
949463663 3:4321393-4321415 GCTAATTCTGCTACTAAAGAAGG + Intronic
950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG + Intergenic
950623422 3:14226141-14226163 TCTATTTCTGCTACCAAAGGAGG - Intergenic
951792465 3:26501489-26501511 GCTACTTCTGCTACTAAAGGAGG - Intergenic
957252306 3:77788751-77788773 GCCACTGTTGCAACTACAGGTGG - Intergenic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
971909511 4:32777348-32777370 GCTACTGCTAGAGCTAAAGGGGG + Intergenic
972486224 4:39543525-39543547 TCTATTTCTGCTACTGAAGGAGG + Intergenic
975737852 4:77399087-77399109 TCTATTTCTGCTACCAAAGGAGG + Intronic
979708278 4:123747481-123747503 GCTATTTCTGCCCCTAGAGGAGG + Intergenic
987216959 5:15747540-15747562 GCTACTGCTGAAAATAAAGAAGG - Intronic
987799068 5:22669514-22669536 GCTTTTCTTGCAACTAAAGGTGG + Intronic
990013595 5:51030124-51030146 ACTAATGCTGCAAGTAAATGTGG - Intergenic
990350890 5:54914841-54914863 GCTACTGTTGCATCTGAAGGAGG - Intergenic
995753155 5:115474631-115474653 GCTACTGCTGTAACCAGAGGTGG + Intergenic
997038527 5:130223139-130223161 CCTAATACTGCAACTAAATGGGG + Intergenic
998264966 5:140660921-140660943 TCTACTGCTGCAGCTAAAGGAGG - Intronic
998898655 5:146828088-146828110 GCAATAGTTGCAACTCAAGGAGG + Intronic
1003293340 6:4802091-4802113 GCTATTGCTGCAAAACATGGGGG - Intronic
1003380842 6:5623382-5623404 GTTATTCCTGCAATTTAAGGAGG + Intronic
1003743583 6:8972281-8972303 GTTATTCCTGCAACTTAAGGTGG - Intergenic
1010257859 6:73779666-73779688 ACTATTGCTGCAATGAACGGTGG + Intronic
1011557752 6:88587605-88587627 GCTATGGCAGCAGCTAAAAGTGG - Intergenic
1028480992 7:91304359-91304381 GCATTTTCTGCAACTAAAGATGG + Intergenic
1028878937 7:95857214-95857236 GCTATTGCTGCAACTAAAGGAGG - Intronic
1029952047 7:104596366-104596388 GATATTGCTGCCTCTAAAGAAGG - Intronic
1041632733 8:60106209-60106231 GCTATTCCTCCAATCAAAGGTGG - Intergenic
1045626890 8:104062634-104062656 GCTATTGGCTCACCTAAAGGTGG - Intronic
1045967212 8:108039259-108039281 GGAATTGCTGCAAGTAAAAGGGG - Intronic
1049854359 8:144852346-144852368 GCAAGTGCGGCAACTAAAGAGGG + Intronic
1051140754 9:13976775-13976797 GGTATTGCTACAACGATAGGAGG + Intergenic
1053578641 9:39379588-39379610 GCATTTGCTGCAACTAAAAAAGG - Intergenic
1053843163 9:42207667-42207689 GCATTTGCTGCAACTAAAAAAGG - Intergenic
1054100224 9:60938392-60938414 GCATTTGCTGCAACTAAAAAAGG - Intergenic
1054121623 9:61214019-61214041 GCATTTGCTGCAACTAAAAAAGG - Intergenic
1054586121 9:66968490-66968512 GCATTTGCTGCAACTAAAAAAGG + Intergenic
1054799371 9:69331934-69331956 GCTACTGCTGCCACCAAGGGAGG + Intronic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1055887084 9:81076188-81076210 ACTTTTGCTGCAAATCAAGGAGG + Intergenic
1056072145 9:82998511-82998533 GCTTTTGCTTCATCTAAAGAAGG - Intronic
1057981354 9:99667027-99667049 GCTTTTGCTGGAATTAATGGTGG - Intergenic
1058044634 9:100343244-100343266 GAAATTGCTGCAACTAGATGGGG + Intronic
1203531958 Un_GL000213v1:153528-153550 GCTGCTCTTGCAACTAAAGGTGG - Intergenic
1187504143 X:19865075-19865097 GTTATTTCTGTAACTGAAGGTGG + Intronic
1190989411 X:55530246-55530268 GTTATTGCTACAACTAGAGCTGG - Intergenic
1191139719 X:57104071-57104093 TCTATTTCTGCTACTGAAGGAGG - Intergenic
1192769913 X:74178090-74178112 TCTATTTCTGCCACTGAAGGAGG - Intergenic
1197367811 X:125587062-125587084 CTTATTGCTGCAAGTAAAGATGG + Intergenic
1198873353 X:141198420-141198442 TCTATTTCTGCTACTGAAGGAGG + Intergenic