ID: 1028879084

View in Genome Browser
Species Human (GRCh38)
Location 7:95859475-95859497
Sequence CTGGGTAAGATGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 420}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028879084_1028879093 27 Left 1028879084 7:95859475-95859497 CCTTCCACATTCATCTTACCCAG 0: 1
1: 0
2: 0
3: 55
4: 420
Right 1028879093 7:95859525-95859547 TCCAAAGCCCCAGTCCACTGTGG No data
1028879084_1028879091 3 Left 1028879084 7:95859475-95859497 CCTTCCACATTCATCTTACCCAG 0: 1
1: 0
2: 0
3: 55
4: 420
Right 1028879091 7:95859501-95859523 TTCTGGGCAGCCATCTGGCATGG No data
1028879084_1028879090 -2 Left 1028879084 7:95859475-95859497 CCTTCCACATTCATCTTACCCAG 0: 1
1: 0
2: 0
3: 55
4: 420
Right 1028879090 7:95859496-95859518 AGAGATTCTGGGCAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028879084 Original CRISPR CTGGGTAAGATGAATGTGGA AGG (reversed) Intronic
901147222 1:7073442-7073464 CTGGGTGAGATGACTGGGGAGGG + Intronic
902143436 1:14376208-14376230 CTGGGTATGATGCATGTACAGGG - Intergenic
902632115 1:17711087-17711109 CAGGGTAAGTTAAATGTGGTTGG + Intergenic
903362929 1:22788299-22788321 CAGGGGAAGATGAGAGTGGAAGG - Intronic
904179400 1:28655314-28655336 TTGGGAAAGAGGTATGTGGATGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905786542 1:40762495-40762517 CTGGGGCAGGTGAATTTGGAGGG - Intronic
906175434 1:43767308-43767330 CAGGGGAAGATGGATGTGGCTGG + Intronic
906566363 1:46803955-46803977 CTGGGTCTGAAGAATCTGGAGGG + Intronic
906725806 1:48043351-48043373 CTTGGGAAGATTAATGTGGAAGG - Intergenic
906789237 1:48644281-48644303 CTGTGTGAGATGAATCTTGAAGG - Intronic
907597435 1:55732779-55732801 TTGGGGAAGAGGTATGTGGATGG + Intergenic
908737472 1:67291469-67291491 TTGGGGAAGAGGTATGTGGATGG + Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
909577018 1:77186514-77186536 TTGGGGAAGAGGTATGTGGATGG + Intronic
910161729 1:84279404-84279426 CCTGGTTAGATGGATGTGGATGG - Intergenic
910370724 1:86512787-86512809 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910790422 1:91044399-91044421 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910831010 1:91462765-91462787 TTGGGGAAGAGGCATGTGGATGG - Intergenic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911257247 1:95646706-95646728 TTGGGGAAGAGGTATGTGGATGG - Intergenic
911738306 1:101361275-101361297 CTGGGGAAGAGGTATGTGGCTGG - Intergenic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
913494998 1:119420343-119420365 TTGGGTAGTCTGAATGTGGAGGG - Intronic
913581610 1:120232816-120232838 CTGGCTCAGATGAATGATGACGG - Intergenic
913626567 1:120665572-120665594 CTGGCTCAGATGAATGATGACGG + Intergenic
914259647 1:145988199-145988221 CTGGGAAGGAAAAATGTGGAGGG - Intergenic
914563542 1:148844263-148844285 CTGGCTCAGATGAATGATGACGG - Intronic
914609285 1:149285962-149285984 CTGGCTCAGATGAATGATGACGG + Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
916906941 1:169296248-169296270 CTTTGTAAGGTGAATGTTGATGG - Intronic
916948056 1:169749109-169749131 CTAGGTAAGATCAATGATGAAGG - Intronic
917217132 1:172690255-172690277 TTGGGGAAGAGGTATGTGGATGG - Intergenic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918526805 1:185473664-185473686 TTGGGGAGGATGATTGTGGATGG + Intergenic
918528931 1:185496080-185496102 CTGGCTGAGATGAAGGTGGTGGG + Intergenic
918734699 1:188044366-188044388 GTGTCTAAGATGAATGTGAAAGG - Intergenic
918755618 1:188337151-188337173 TTGGGCAAGAGGTATGTGGATGG - Intergenic
918958321 1:191238589-191238611 CTGGGCAAGAGGTATGTGGATGG + Intergenic
920197524 1:204239024-204239046 TTGGGGAAGAGGTATGTGGATGG + Intronic
920349692 1:205329621-205329643 TGGAGTAAGATGAATTTGGAAGG + Intergenic
920794378 1:209124411-209124433 CTGGTTTTGATGAATGTGGCTGG + Intergenic
921374597 1:214460795-214460817 CTGGGAAAGCTGAATGTGCTAGG - Intronic
923137416 1:231130664-231130686 CTGGCTCACATGACTGTGGAAGG - Intergenic
923253487 1:232198794-232198816 TTGGGGAAGAAGTATGTGGATGG - Intergenic
923299379 1:232627546-232627568 CTGTGTAATATGGATTTGGAAGG - Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924829598 1:247579052-247579074 CTGGGGAAGAATTATGTGGATGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1064264018 10:13809856-13809878 CTTGGTGAGATGCAAGTGGAAGG - Intronic
1064306295 10:14169877-14169899 CTGAGTGGGATGACTGTGGAAGG - Intronic
1066166936 10:32798572-32798594 TTGGGGAAGAGGTATGTGGATGG - Intronic
1067333228 10:45340875-45340897 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068007581 10:51408924-51408946 CTGGGGAAGAGGTGTGTGGATGG - Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1069133945 10:64740829-64740851 CTGGGTTAGATGAATTTGGTTGG - Intergenic
1069192218 10:65505714-65505736 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1071266988 10:83973348-83973370 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1072798150 10:98372392-98372414 CTATGTCAGATGTATGTGGAGGG + Intergenic
1073557440 10:104466549-104466571 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1073656596 10:105423836-105423858 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1073747959 10:106491557-106491579 GTGGGCAAGATGACAGTGGAAGG - Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075808805 10:125209387-125209409 CTGAGCTAGAGGAATGTGGAAGG - Intergenic
1076574849 10:131457760-131457782 CAGTGGAAGATGAAAGTGGATGG + Intergenic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077481335 11:2816032-2816054 CTCCGTTAGATGAATGTGGACGG + Intronic
1080191204 11:29551507-29551529 CTAGGTATGATGAATTTGAATGG - Intergenic
1081501363 11:43669905-43669927 CTGGGTAACATGACTGTTGCAGG - Intronic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1083178164 11:60965939-60965961 CTGGGGTAGAGGCATGTGGATGG + Intergenic
1083186111 11:61018862-61018884 GTGGGGAAAATGGATGTGGACGG + Intronic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1083507977 11:63178452-63178474 CTGGGGAAGATGCATATAGAGGG - Intronic
1083540854 11:63510688-63510710 CTTGGGAAGATGAATGGGGGTGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085686047 11:78622822-78622844 CTGGGGGAGAGGTATGTGGATGG + Intergenic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1088097297 11:106115789-106115811 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1089416999 11:118300514-118300536 CTGGGGAAGATGCACGTGTATGG + Intergenic
1090080994 11:123612611-123612633 GAGGGTGAGATGGATGTGGAAGG + Intronic
1090221524 11:125030968-125030990 CTGGGGAAGAGTTATGTGGACGG - Intronic
1090497934 11:127232850-127232872 CAGGGTACCATGAATGTGGCTGG - Intergenic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1091833879 12:3570521-3570543 CTTGGCAAGATTACTGTGGAGGG + Intronic
1092093370 12:5822282-5822304 CTGGGGAAGAGGTATGTAGATGG + Intronic
1092231273 12:6776939-6776961 CTGAATAAGATAAATGTGGCCGG + Intronic
1092971927 12:13704391-13704413 CTGGGTAAAATGCATGTTCAAGG - Intronic
1093031776 12:14295303-14295325 CTGGGGAAGAGGTATGTGGGTGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093645809 12:21584303-21584325 TTGGGGAAGAGGTATGTGGATGG + Intronic
1095192435 12:39272834-39272856 CTGGGTAAGTTTAATGCGCATGG - Intergenic
1095475496 12:42583295-42583317 CTGGGTAAGGTGGATGTGTCTGG + Intronic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095852449 12:46825832-46825854 GTGGGTGAGACGAACGTGGAAGG - Intronic
1096053551 12:48631990-48632012 CCTGGTAAGAGGAATGTGAAGGG + Intergenic
1096457374 12:51798816-51798838 TTGGGGAAGAGGTATGTGGATGG - Intronic
1097564562 12:61251811-61251833 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1097843265 12:64342120-64342142 TTGGGGAAGAGGTATGTGGATGG - Intronic
1098749929 12:74280228-74280250 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1098989085 12:77045101-77045123 CTTGGAAAGATTAATGTAGAAGG + Intronic
1099183297 12:79491971-79491993 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1100866708 12:98865325-98865347 CTTGGGCAGATGAATGGGGAGGG - Intronic
1103035709 12:117654704-117654726 TTGGGGAAGAGGTATGTGGATGG + Intronic
1105837978 13:24227117-24227139 CTGGGTGAGATGAAGGATGAAGG + Intronic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1109091054 13:58046537-58046559 CTGAGTATTAGGAATGTGGAGGG + Intergenic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1110377253 13:74807102-74807124 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1110834051 13:80063997-80064019 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111535285 13:89595805-89595827 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1112249841 13:97769647-97769669 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1112363429 13:98737806-98737828 ATAGGTCAGAAGAATGTGGAGGG + Intronic
1113319613 13:109221040-109221062 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1114205951 14:20571402-20571424 TTGGGGAAGATGTATGTGGATGG + Intergenic
1116058989 14:39897558-39897580 TTGGGTAAGAGGTATGTGGATGG + Intergenic
1116430457 14:44840041-44840063 CTGGCTAATATGAATGAGGAGGG + Intergenic
1116631502 14:47341141-47341163 TAGAGTAAGATCAATGTGGAGGG - Intronic
1117422673 14:55562340-55562362 TTGGGTGAGATGAAGCTGGATGG + Intronic
1118122348 14:62859537-62859559 TTGGGGAAGAGGTATGTGGATGG - Intronic
1118880689 14:69823388-69823410 TTGGGAAAGAGGTATGTGGACGG - Intergenic
1120081936 14:80226897-80226919 GTGGGGAAGACGTATGTGGATGG - Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120555906 14:85929805-85929827 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1121554406 14:94825367-94825389 ATGGGGAAGATGAATGGGGTGGG + Intergenic
1122800995 14:104229424-104229446 CTGGGTAGGATGCATCTGCAGGG + Intergenic
1125299293 15:38237409-38237431 CTGGCTAAGAAGAATTTGGTTGG + Intergenic
1126199895 15:45973871-45973893 CTGGGGAAGATGCATGTAGGAGG + Intergenic
1127812822 15:62579320-62579342 TTGGGAAAGATGAATTTTGAGGG + Intronic
1128642893 15:69352857-69352879 TTGGGGAAGAGGTATGTGGATGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1133980725 16:10631421-10631443 CTGTGTAAGATGAGATTGGAAGG + Intronic
1134639384 16:15817769-15817791 ATGGGTATGATGAGTGTGGCAGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135863908 16:26082817-26082839 CTTGGTAAGATGCAAGGGGATGG - Intronic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1138868466 16:60851415-60851437 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1139374465 16:66488091-66488113 CTGGGAAAGATGAGAGTGGCTGG + Intronic
1139406508 16:66723236-66723258 GTGGGGAAGCTGAATGTTGAGGG - Exonic
1140029198 16:71321098-71321120 CTGGGATAGATGAATGGAGAAGG + Intergenic
1140476607 16:75242281-75242303 CCGGGGAAGATGGATGTGAATGG - Intronic
1140534955 16:75701405-75701427 CTGCCCAAGATGAATTTGGAGGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1143803991 17:9410106-9410128 TTGGGTGGGATGAAGGTGGAGGG - Intronic
1144140090 17:12340034-12340056 CTGGGTAAGATGCATCTTAATGG + Intergenic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1151037716 17:70820967-70820989 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1151585460 17:75005631-75005653 CTGGGGGAGAGGAGTGTGGAAGG + Exonic
1151904178 17:77036866-77036888 CTGGGTGCTAGGAATGTGGACGG - Intergenic
1152164883 17:78696898-78696920 CTTGGCAATAGGAATGTGGAAGG + Intronic
1153631699 18:7076702-7076724 CTGGGAAAATTGAATGTGGATGG + Intronic
1155762717 18:29587657-29587679 CTGGGTAAGATGTATGTTCTGGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156998664 18:43498358-43498380 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157341295 18:46780653-46780675 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159325321 18:66907989-66908011 CTGTGTAAGATGAGTACGGAGGG - Intergenic
1159559016 18:69974735-69974757 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1159796512 18:72850942-72850964 CTGGGGAATCTGAATGTGCATGG + Intronic
1160409785 18:78667812-78667834 CGGGGTAGGATGGATGGGGAGGG - Intergenic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1164117171 19:22233943-22233965 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1164551715 19:29217699-29217721 CTAGGTGAGATGAAAGTGGCTGG - Intergenic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1167032985 19:46975797-46975819 GTGGCTATGATGAATGTGGAGGG - Intronic
1167692464 19:50994923-50994945 TAGGGAAAGATGAGTGTGGAGGG - Intergenic
1168313594 19:55473831-55473853 CTGGGTCATAGCAATGTGGAGGG - Intergenic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925460808 2:4061075-4061097 TTGGGGAAGAGGTATGTGGATGG + Intergenic
925772653 2:7298386-7298408 CTGGGGAAGACGTATGTGGATGG - Intergenic
926515598 2:13841189-13841211 CTGGGTAAGAAGATTTTGTAAGG + Intergenic
926826854 2:16914297-16914319 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927008798 2:18880353-18880375 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927069030 2:19506160-19506182 CTGGGAAAGCTGAACGTGTATGG + Intergenic
929018136 2:37522340-37522362 TTGAATCAGATGAATGTGGATGG + Intergenic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
930536525 2:52651635-52651657 CTGGGGAAGAGGTATGTAGATGG - Intergenic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
931864049 2:66390825-66390847 TTGCGTAAGATTAATCTGGAAGG + Intergenic
932010751 2:67975227-67975249 CTAGGTAAAATGAAAGTGGGAGG - Intergenic
933394386 2:81712725-81712747 TTGGGGAAGAGGTATGTGGATGG - Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
935184030 2:100715526-100715548 CTAGGGAAGAAGTATGTGGATGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937785115 2:125887097-125887119 TTGGGGAAGAGGTATGTGGATGG - Intergenic
937852481 2:126648107-126648129 TTGGGGAAGAGGTATGTGGATGG - Intergenic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
938960001 2:136332211-136332233 GTGGGAAAGGTGCATGTGGAAGG + Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
943330859 2:186557426-186557448 CTAGCTAAGATGATTGAGGAAGG - Intergenic
943383983 2:187180462-187180484 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943517510 2:188906627-188906649 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943833528 2:192490516-192490538 TTGGGGAAGAGGTATGTGGATGG - Intergenic
945148935 2:206767676-206767698 CTGGGGATGGTAAATGTGGAAGG - Intronic
945293462 2:208147597-208147619 CTGGGGTAGAGGAATGTGCAGGG - Intergenic
945544950 2:211138774-211138796 TTGGGAAAGAGGTATGTGGATGG + Intergenic
945642264 2:212444466-212444488 CTGGGGAAGAGGTATGTGGGTGG + Intronic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
946703676 2:222437165-222437187 TTGGGGAAGAGGTATGTGGATGG - Intronic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
948990288 2:241550632-241550654 CTGGGAAAAGTGAATGGGGAGGG + Intergenic
1174459782 20:50674114-50674136 CTGGGTAAGATGTGTCTGGAAGG + Intronic
1174664560 20:52245844-52245866 CTGGGTAGGAAAAATGAGGATGG + Intergenic
1174995224 20:55559297-55559319 TTGGCAAAGATGAATGTTGATGG - Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1177139327 21:17341634-17341656 TTGGGGAAGATGTATGTGGATGG - Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1177913262 21:27056839-27056861 TTGGGAAAGAGGTATGTGGATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1179363288 21:40732907-40732929 CTGGGTAAGATCCATGTGATTGG + Intronic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179712021 21:43268925-43268947 CTGGGCAGGATGGATGTGGGTGG - Intergenic
1180853797 22:19034177-19034199 CATGGTGAGATGAAGGTGGAAGG + Intergenic
1181258769 22:21582321-21582343 CTGGGTGGTATGAATGTGGTGGG + Intronic
1181920919 22:26319926-26319948 CTGGCTATGATGCACGTGGAGGG + Intronic
1182944608 22:34310262-34310284 CTGAGAAAGAAGAATGTGTATGG + Intergenic
1183008540 22:34925278-34925300 CTGGGTTATAAGAATATGGAAGG - Intergenic
1183261082 22:36796434-36796456 CTGGATAATATGACTGTGCAGGG - Intergenic
1183950091 22:41347932-41347954 CTGGGTCAGAGGAGTGAGGAAGG - Intronic
949245961 3:1925554-1925576 TTGGGGAAGAGGTATGTGGATGG + Intergenic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950173696 3:10856732-10856754 CTGGGTAATTTGAAAATGGATGG + Intronic
950203849 3:11062944-11062966 CTGAGCCAGATGAGTGTGGAGGG + Intergenic
951291434 3:20876114-20876136 TTGGGGAAGAGGTATGTGGATGG - Intergenic
951384609 3:22028148-22028170 TTGGGGAAGAGGTATGTGGATGG + Intronic
951607538 3:24452599-24452621 CTGGGTTGGAGGAAAGTGGAAGG - Intronic
951970677 3:28441259-28441281 TTGGGGAAGAGGTATGTGGATGG - Intronic
953381769 3:42477619-42477641 CTAGGGGAGGTGAATGTGGAGGG - Intergenic
953755958 3:45646135-45646157 TTGTGTAAGATGAGTGTGGCTGG - Intronic
954054247 3:48008587-48008609 TTGGGGAAGAGGTATGTGGATGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
956146765 3:66198580-66198602 CTGGGTGAGAGTAATGTAGAGGG - Intronic
957247482 3:77733266-77733288 TTGGGGAAGAGGTATGTGGATGG - Intergenic
957514498 3:81233030-81233052 CTGAGTAAGAGGCATGTTGATGG - Intergenic
957754673 3:84470056-84470078 TTGGACAAGATGTATGTGGATGG + Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
959522037 3:107332170-107332192 CACAGTTAGATGAATGTGGAGGG + Intergenic
959864805 3:111253731-111253753 ATGGGTAAGTTGTGTGTGGAGGG + Intronic
960349610 3:116576331-116576353 TTGGGGAAGAAGTATGTGGATGG + Intronic
961570620 3:127795858-127795880 CTGGGTGATAAGATTGTGGATGG - Intronic
964303805 3:155319091-155319113 ATAAGTAATATGAATGTGGAGGG + Intergenic
964679148 3:159318285-159318307 TTGGGGAAGAGGTATGTGGATGG - Intronic
965291662 3:166888962-166888984 TTGGGTAAGAGGTATGTGGATGG - Intergenic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968384287 4:122670-122692 CTGGGTACCTGGAATGTGGATGG + Intergenic
968907094 4:3459042-3459064 TTGGGGAAGAGGTATGTGGATGG + Intergenic
969343402 4:6556613-6556635 CTGGGGAAGAGGTGTGTGGATGG - Intronic
970514075 4:16810293-16810315 GTGGGTAGGATGATTTTGGAGGG - Intronic
971100928 4:23465792-23465814 CTGGGGAAGAGGTATGTGAATGG - Intergenic
971687302 4:29786458-29786480 TTGGGGAAGACGTATGTGGATGG - Intergenic
971764875 4:30817979-30818001 CTGAGTGAGAAGAATGTGGCAGG - Intronic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972464066 4:39335781-39335803 GTGGGGAAGATGTATGTGAATGG - Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
973130101 4:46639068-46639090 TTGGGGAAGAGGTATGTGGATGG - Intergenic
973804603 4:54513708-54513730 CTGGATAAGATGGAGGTGCATGG + Intergenic
973901250 4:55474462-55474484 CTGGGTAAGATCATTGATGAAGG + Intronic
974289650 4:59913372-59913394 TTGGGGAAGAGGTATGTGGATGG + Intergenic
974564876 4:63568939-63568961 TTGGGAAAGAGGTATGTGGATGG + Intergenic
974746825 4:66088275-66088297 TTGGGGAAGAGGTATGTGGATGG - Intergenic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
977031734 4:91892438-91892460 TTGGGAAAGAGGTATGTGGACGG + Intergenic
977833143 4:101617208-101617230 TTGGGGAAGAGGTATGTGGATGG - Intronic
978341495 4:107724919-107724941 TTGGGGAAGAGGTATGTGGATGG - Intergenic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
979898329 4:126188438-126188460 TTGGGGAAGAGGTATGTGGATGG - Intergenic
980821605 4:138023773-138023795 CTGGGTAAGATGGCAGTTGATGG - Intergenic
981423363 4:144576842-144576864 CTGGTGACCATGAATGTGGATGG - Intergenic
981497497 4:145410577-145410599 CTGGTTTACATGATTGTGGAGGG + Intergenic
982300995 4:153879406-153879428 CTGGGGAAGAGATATGTGGATGG + Intergenic
982597686 4:157406415-157406437 TTGGGGAAGAGGTATGTGGATGG - Intergenic
983185152 4:164692203-164692225 TTGGGGAAGAGGTATGTGGAAGG + Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
983365382 4:166780490-166780512 GTAGGGAAGATGGATGTGGATGG - Intronic
983486539 4:168338207-168338229 CAGTGCAAGATGAGTGTGGAGGG - Intergenic
983582766 4:169325442-169325464 TTGGGGAAGAAGTATGTGGATGG + Intergenic
985222604 4:187723745-187723767 CTGGGTCAGGTGACTGTGCAGGG + Intergenic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985733020 5:1561470-1561492 TTGGATAATAAGAATGTGGAGGG + Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986261542 5:6151893-6151915 TTGGGGAAGAGGTATGTGGATGG - Intergenic
986743038 5:10720389-10720411 TTGGGGAAGAGGTATGTGGATGG + Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987367087 5:17158504-17158526 CTGGCTAGGAAGGATGTGGAGGG - Intronic
987468059 5:18296015-18296037 TTGGGGAAGAGGTATGTGGATGG - Intergenic
987740447 5:21901665-21901687 CTGGTTGAAATGAATCTGGAGGG - Intronic
988107837 5:26773175-26773197 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988188869 5:27901871-27901893 TTGGGGAAGAGGTATGTGGATGG + Intergenic
989307413 5:39973993-39974015 TTGGGGAAGAGGCATGTGGATGG - Intergenic
989403777 5:41038060-41038082 TTGGCTGGGATGAATGTGGAGGG + Intronic
989457561 5:41661138-41661160 TTGGGGAAGAAGTATGTGGATGG - Intergenic
989704664 5:44314701-44314723 CTGGGAAAGATGCTTGTGAATGG - Intronic
990206962 5:53440196-53440218 ATGGGTAAGATTTAGGTGGAAGG + Intergenic
991234248 5:64375796-64375818 TTGGGAAAGAGGAATTTGGATGG + Intergenic
991330653 5:65489054-65489076 TTGGGGAAGAGGTATGTGGATGG - Intergenic
992243040 5:74790482-74790504 TTGGGGAAGAGGTATGTGGATGG + Intronic
992504076 5:77368238-77368260 CTTGGGGAGATGAATCTGGAAGG - Intronic
992987707 5:82250622-82250644 CAGGGTAACATGATTCTGGAGGG - Intronic
993267585 5:85746003-85746025 CTGGGTTAGATAAGTGTGGAAGG - Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994408698 5:99379135-99379157 CTGTGGAAGATGAATTTGAAAGG - Intergenic
996018646 5:118568490-118568512 TTGGGGAAGAGGTATGTGGATGG + Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996774492 5:127119303-127119325 CTGGGGTAGAGGCATGTGGATGG + Intergenic
996801595 5:127409562-127409584 CTAGGTAAGACGAATGAGGTGGG - Intronic
996825652 5:127678470-127678492 TTGGGGAAGAGGTATGTGGATGG + Intergenic
997668592 5:135651899-135651921 CTGGGGAAGATATATATGGATGG + Intergenic
1000417055 5:160994530-160994552 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1002195439 5:177498413-177498435 GTGGGTGTGATGACTGTGGATGG - Intergenic
1003291953 6:4787585-4787607 CTGGGCAAGCTGAATGTGTCTGG - Intronic
1003695808 6:8405520-8405542 TTGGGGAAGAAGTATGTGGAGGG - Intergenic
1003758698 6:9150709-9150731 TTGGGGAAGAGGTATGTGGAGGG + Intergenic
1003791317 6:9550676-9550698 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1005185259 6:23157694-23157716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005892662 6:30153076-30153098 CTGGGTGAGATTAAGGTGCAGGG - Exonic
1005970766 6:30759681-30759703 CCGGGTGAGATCACTGTGGATGG + Intergenic
1006257082 6:32840556-32840578 CTTGGAGAGATGAGTGTGGAAGG + Intergenic
1006507705 6:34500798-34500820 CTAGCTAAGATCACTGTGGAAGG - Intronic
1008079291 6:47177940-47177962 TTGGGGAAGAGGCATGTGGATGG - Intergenic
1008400371 6:51056095-51056117 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1009660602 6:66606300-66606322 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1011186692 6:84684517-84684539 CTGGGTTAGGTGATTTTGGAGGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014294081 6:119596791-119596813 CTAGGTAAGATGATTGATGAAGG - Intergenic
1014363317 6:120507723-120507745 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1014417074 6:121196018-121196040 TTGGGGAAGAAGTATGTGGATGG + Intronic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1014631728 6:123797430-123797452 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1014945254 6:127489880-127489902 CTAGGTAAGATGATTGGTGAAGG + Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015937634 6:138418953-138418975 CTGGGGTAGAGGCATGTGGATGG + Exonic
1016119841 6:140332063-140332085 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1016419528 6:143870040-143870062 TTGGGGAAGAGGTATGTGGATGG - Intronic
1017227718 6:152040462-152040484 TTGGGGAAGAGGTATGTGGATGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017846681 6:158264568-158264590 CTGGGGAAGATGCACCTGGAGGG + Intronic
1018599978 6:165528166-165528188 TTGGGGAAGAGGTATGTGGATGG + Intronic
1019578378 7:1748548-1748570 GTGGGTGAGATGCATATGGAGGG - Intergenic
1019717474 7:2546330-2546352 CTCGGGAAGCTGAATGGGGAGGG + Intronic
1020456321 7:8377329-8377351 CTGTGTAGGATGAATTAGGAAGG - Intergenic
1021282831 7:18741060-18741082 CTCTGTAACATGAAAGTGGAAGG + Intronic
1022063958 7:26831422-26831444 CTGGCTAAGATGAATTTTGTAGG - Intronic
1022074963 7:26959129-26959151 CTGGGCAAGATGGAGCTGGAAGG + Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1023645371 7:42307135-42307157 CTCCGTAAGATGAAAGTGCAAGG + Intergenic
1024215265 7:47243246-47243268 CTAGGTAAGAGGAATGGGCAGGG - Intergenic
1024743082 7:52376238-52376260 CTGAGTAAGAGGCGTGTGGATGG + Intergenic
1024744297 7:52389053-52389075 CCGGGGAAGAGGTATGTGGATGG + Intergenic
1024783179 7:52875586-52875608 ATGGGTAGGATGAAAGTGGTGGG + Intergenic
1025734663 7:64136385-64136407 GTGGGTAAGATGAATCTTGCAGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027685888 7:81278586-81278608 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028763978 7:94529644-94529666 CTGAGTAATAGGAATGTGGCTGG + Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1028935103 7:96455694-96455716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1032263893 7:130357050-130357072 CTGGGTAAGTTAGATGTGGCCGG - Intronic
1033076346 7:138253675-138253697 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034438404 7:151074625-151074647 AGGGTTAAGGTGAATGTGGAGGG - Intronic
1034478965 7:151305130-151305152 TTGGGTCAGATGGATGTTGATGG + Intergenic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1036080338 8:5548419-5548441 CTGGGGAAGATGAAATTGGGTGG + Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1041986269 8:63925098-63925120 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1042162378 8:65910044-65910066 CTGGGGAAGATACATGTGGATGG - Intergenic
1042363405 8:67908266-67908288 CTGGGTAGCATGAATGAGGCTGG - Intergenic
1043258012 8:78159447-78159469 TTGGGAAAGATGTATGTGGATGG + Intergenic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1044266645 8:90189746-90189768 CTTGGTAAGCTGACTGAGGAGGG + Intergenic
1044633063 8:94297774-94297796 CTGGGGAAGAGGTATGTGAATGG - Intergenic
1046241744 8:111505318-111505340 GTAGGGAAGATAAATGTGGAAGG + Intergenic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046937742 8:119901827-119901849 CTGGGTGAGATGAAAATGTAAGG + Intronic
1047198807 8:122746150-122746172 CTGGGAAAGAGGATTTTGGAGGG - Intergenic
1048114303 8:131504685-131504707 CTGAGTGAGATGATAGTGGAGGG - Intergenic
1048437383 8:134431223-134431245 CTGGGAGAGATGAAGGTAGACGG + Intergenic
1048919350 8:139213707-139213729 CTGGCTTAGAGGGATGTGGAGGG - Intergenic
1050124526 9:2342920-2342942 CTGGGAAAAAGGTATGTGGATGG + Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052227670 9:26109000-26109022 TTGGGGAAGAGGTATGTGGATGG + Intronic
1052234177 9:26189456-26189478 CTGGATGAGCTGAATGTTGAAGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052737256 9:32354949-32354971 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1053246938 9:36542329-36542351 TTGGGTAATCTGAATGTAGAGGG + Intergenic
1053470965 9:38346020-38346042 CCGGGTAAGATGCAGGTGGGAGG - Intergenic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1055318837 9:75061999-75062021 CTGTGTAATAAGAATGTGGTAGG - Intronic
1055320374 9:75078072-75078094 CTGGGAAAGATGAAGGAGAAAGG + Intronic
1056156760 9:83845833-83845855 TTGGGGAAGAGGTATGTGGATGG + Intronic
1056314145 9:85372317-85372339 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056353776 9:85777693-85777715 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1057038126 9:91826483-91826505 CTGGGTTAAATAAATGTGGCTGG + Intronic
1057167502 9:92940509-92940531 TTGTGCTAGATGAATGTGGAGGG + Intergenic
1057896270 9:98911510-98911532 CTGTGTAATATGTATGTGTAGGG + Intergenic
1059139115 9:111835333-111835355 TTGGGTTAGATGAAGGTTGAGGG - Intergenic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1060216260 9:121740260-121740282 CTGGGAAAGATCACTGTGGGGGG - Intronic
1060472448 9:123959513-123959535 GTGGGAAAGAGGAATTTGGATGG - Intergenic
1060800799 9:126544835-126544857 CTGGGTGAGAAGATTATGGATGG + Intergenic
1060805681 9:126574691-126574713 CTGGGGAACATGTATGGGGATGG - Intergenic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1186384008 X:9091133-9091155 TTGGGGAAGAGGTATGTGGATGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1188024266 X:25192587-25192609 CTGGGTGTGAGGAATGTGGGTGG + Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1188965394 X:36545352-36545374 CTGGGGAAAATGAAAGTGTAGGG - Intergenic
1188972918 X:36639110-36639132 CTGGGCAAGAGACATGTGGATGG + Intergenic
1189154797 X:38746105-38746127 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1189564324 X:42224874-42224896 CTTGGTAAGTTGAATGTGTCCGG + Intergenic
1189659355 X:43279879-43279901 CTGGGTAAGTTGCATGTTGTGGG + Intergenic
1189911671 X:45816414-45816436 CTGGGTAAGAATTATGTGGGAGG - Intergenic
1190787787 X:53669047-53669069 CTGGTTCAAATGAATTTGGAAGG + Intronic
1191941178 X:66483251-66483273 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1191946434 X:66539647-66539669 CTGGGGAAGAGGTATGTGGCTGG + Intergenic
1192695603 X:73412311-73412333 CTGGGTTAGATGAATGTTAGTGG + Intergenic
1192898791 X:75472533-75472555 TTGGGGAAGAGGTATGTGGATGG + Intronic
1193447239 X:81619388-81619410 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195748847 X:108144735-108144757 TTGGGGAAGAGGTATGTGGATGG - Intronic
1195782267 X:108479237-108479259 TTGGGAAAGAGGTATGTGGATGG - Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196374783 X:115021133-115021155 ATGCCTAAGATCAATGTGGAGGG + Intergenic
1196591482 X:117490385-117490407 GGGTGGAAGATGAATGTGGAGGG - Intergenic
1197002381 X:121453545-121453567 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1197084118 X:122452872-122452894 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197148191 X:123191655-123191677 CTAGGTAAGTTTAGTGTGGATGG - Intronic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1197244963 X:124158365-124158387 TTGGGGAAGAGGTATGTGGATGG - Intronic
1197409245 X:126095818-126095840 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197582868 X:128306681-128306703 TTGGGTAAGATTAAACTGGAAGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1198676995 X:139141637-139141659 CTGGGATGGAAGAATGTGGAGGG - Intronic
1198701389 X:139400924-139400946 CTGGGGAAGAGGTATATGGATGG + Intergenic
1199025080 X:142927097-142927119 CTGGGAAAGGTGAGTGGGGAAGG + Intergenic
1199139314 X:144290663-144290685 CTGGGTAAGAATAATATGGTTGG + Intergenic
1199310350 X:146313773-146313795 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1200521351 Y:4212654-4212676 TTGGGTAAGAATTATGTGGATGG + Intergenic
1200745969 Y:6904244-6904266 TTGGGGAAGAAGTATGTGGATGG - Intergenic