ID: 1028879451

View in Genome Browser
Species Human (GRCh38)
Location 7:95863645-95863667
Sequence CTAGTTACCTTGAAAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028879451_1028879453 1 Left 1028879451 7:95863645-95863667 CCTTTATTTTTCAAGGTAACTAG 0: 1
1: 1
2: 0
3: 15
4: 236
Right 1028879453 7:95863669-95863691 AAGTTTCTTTGAAATCTAGTGGG 0: 1
1: 0
2: 2
3: 42
4: 370
1028879451_1028879452 0 Left 1028879451 7:95863645-95863667 CCTTTATTTTTCAAGGTAACTAG 0: 1
1: 1
2: 0
3: 15
4: 236
Right 1028879452 7:95863668-95863690 AAAGTTTCTTTGAAATCTAGTGG 0: 1
1: 0
2: 1
3: 28
4: 338
1028879451_1028879455 29 Left 1028879451 7:95863645-95863667 CCTTTATTTTTCAAGGTAACTAG 0: 1
1: 1
2: 0
3: 15
4: 236
Right 1028879455 7:95863697-95863719 TTTAGGCCTTCATCACATGTAGG No data
1028879451_1028879454 12 Left 1028879451 7:95863645-95863667 CCTTTATTTTTCAAGGTAACTAG 0: 1
1: 1
2: 0
3: 15
4: 236
Right 1028879454 7:95863680-95863702 AAATCTAGTGGGTTTTCTTTAGG 0: 1
1: 0
2: 0
3: 20
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028879451 Original CRISPR CTAGTTACCTTGAAAAATAA AGG (reversed) Intronic
903666103 1:25008681-25008703 CAATTTCCCTTGAAAAACAATGG + Intergenic
904863707 1:33560080-33560102 CTAGGTCCCTAGAAAAAGAAGGG - Intronic
907745551 1:57209554-57209576 CCTCTTACCTTGAAAAACAAAGG - Intronic
909033978 1:70576047-70576069 CTAGTTTTCTTGTAAAAGAAAGG + Intergenic
911431845 1:97799492-97799514 CTAGTTATCTGAAATAATAAAGG + Intronic
916323714 1:163533949-163533971 CAAGTTACAGAGAAAAATAAGGG - Intergenic
916410536 1:164542841-164542863 ATAGTTTCTTTGAAAAAAAATGG + Intergenic
916870175 1:168905376-168905398 GTACTTGCCTTGAAAAATTATGG - Intergenic
917705432 1:177628926-177628948 CAATTTACATGGAAAAATAAAGG + Intergenic
918832839 1:189420385-189420407 GTAGTCACCTAGAAAAAGAAAGG + Intergenic
921430655 1:215061797-215061819 CTAGTTAGTTTTAATAATAAAGG + Intronic
923896261 1:238273339-238273361 CTAGTTTCCTTGATGAATATGGG + Intergenic
924135690 1:240964193-240964215 CTATTTACCCTGAAAGATTATGG + Intronic
924717504 1:246591203-246591225 CTAGAGAACTTGAAAAATAGTGG + Intronic
1064172082 10:13042583-13042605 TTGGTTACCTTCTAAAATAATGG + Intronic
1064383666 10:14870292-14870314 CTATTAATCTTGGAAAATAAAGG - Intronic
1064506997 10:16042557-16042579 CTACATACCTTGAAAAATGGTGG - Intergenic
1064950983 10:20849990-20850012 CTATTTTCATTGAAAAAAAAAGG + Intronic
1066415050 10:35214006-35214028 CTAGTTTCATTTAAAAATCAGGG + Intergenic
1067395685 10:45914773-45914795 CTAGGTACCTTGAGAAAAATAGG + Intergenic
1067864006 10:49883896-49883918 CTAGGTACCTTGAGAAAAATAGG + Intronic
1068265444 10:54642485-54642507 CTAGATACTATGAAAGATAATGG - Intronic
1071864292 10:89709152-89709174 CTGTTTGCCTTAAAAAATAAAGG - Exonic
1072248837 10:93566364-93566386 CCAGTGTCCCTGAAAAATAAAGG + Intergenic
1073465029 10:103689814-103689836 CTGGTGACCTTGAAAACTGAAGG - Intronic
1079711977 11:23696041-23696063 ATAGTTACTTTGTAAAATAGTGG - Intergenic
1079720076 11:23799910-23799932 ATAGTTGCCTTAAAAAAAAAAGG + Intergenic
1080319348 11:30988405-30988427 CTATTCAGCTTGAAAAAAAATGG + Intronic
1080483834 11:32683567-32683589 TTAGAAACCTTGAAAAATAAGGG + Exonic
1081011269 11:37815439-37815461 CTAGTTACTTAGAAGAACAAAGG + Intergenic
1087838844 11:102902315-102902337 CTAAGTACTGTGAAAAATAAAGG + Intergenic
1088573035 11:111241698-111241720 TTCTTTACCATGAAAAATAATGG + Intergenic
1088573210 11:111243133-111243155 TTCTTTACCATGAAAAATAATGG + Intergenic
1093100509 12:15022912-15022934 CAAATTATTTTGAAAAATAAAGG + Intergenic
1093123596 12:15301797-15301819 CTATTTTCCTTAAAAAATATTGG + Intronic
1093949979 12:25153954-25153976 CTAGTAAACATGAAAAATCATGG + Intronic
1095217017 12:39561058-39561080 ATAATTACCTTGAATATTAATGG + Intronic
1095629837 12:44362668-44362690 CTATTTTCAATGAAAAATAATGG + Intronic
1095739723 12:45593538-45593560 CTAGTTACCTTTCAATAAAAAGG - Intergenic
1095937023 12:47695496-47695518 CAAGGTAACTTCAAAAATAATGG + Intronic
1096931717 12:55217068-55217090 TTAGTTTCCTGGGAAAATAAGGG + Intergenic
1097561674 12:61214315-61214337 CTAGTTGCTTTGAAAAATGTAGG - Intergenic
1097732191 12:63141169-63141191 CTACTTTACTTGAAAATTAAAGG + Intergenic
1098301391 12:69057720-69057742 CCAGTCACCTTGAAAACTATTGG - Intergenic
1099113888 12:78599311-78599333 CAATTTGCCTTAAAAAATAAAGG + Intergenic
1099145404 12:79037282-79037304 GTATGTACCTTGAAAAAAAAAGG - Intronic
1100050069 12:90437373-90437395 CTAGTAACCTTTTAACATAAAGG - Intergenic
1100657632 12:96663815-96663837 CAAGTTATCTTTAAAAAGAAAGG - Exonic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1103168075 12:118787940-118787962 CTTCTTAGCTTCAAAAATAATGG - Intergenic
1106703222 13:32251602-32251624 ATAGTTACCCTTAAAAAAAAAGG + Intronic
1107665568 13:42686440-42686462 CTAGTTATCTTGGTGAATAATGG + Intergenic
1108538245 13:51408541-51408563 TCAGTTACCTGGAAAAATAATGG - Intronic
1108932505 13:55844111-55844133 AGAGTTACCTTGAAACTTAATGG - Intergenic
1108942293 13:55971815-55971837 CTTATTAACTTAAAAAATAAAGG - Intergenic
1109763093 13:66856876-66856898 CTTTTTACCTTGAAAAGGAATGG + Intronic
1109864125 13:68239773-68239795 CTACTTTCCTTGAAAATCAATGG + Intergenic
1110123503 13:71912459-71912481 ATGGCTACCTTGAAAAACAAGGG - Intergenic
1111728103 13:92038759-92038781 CTCAATACCTTGAAAAAGAATGG + Intronic
1115393548 14:32880518-32880540 TTAGTTAGTTTGAAAAATATTGG - Intergenic
1119675809 14:76552743-76552765 CTAATGACATTGAAAAATAAAGG + Intergenic
1119896021 14:78220624-78220646 CCAGTTACCTTAAAAGAAAACGG - Intergenic
1122451010 14:101807477-101807499 CTAAGTACCTGGAAAAATAGAGG + Intronic
1124853693 15:33366207-33366229 TTAATTAACTTGAAAAATATGGG + Intronic
1126687260 15:51259245-51259267 TTTTTTTCCTTGAAAAATAATGG + Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1128686493 15:69690122-69690144 CAAATTACCTCCAAAAATAATGG - Intergenic
1129569415 15:76663988-76664010 TTAGTTACATTTAAAAAAAAAGG + Intronic
1130213312 15:81945908-81945930 CTAGTGGCCTTAAAAAATGAAGG - Intergenic
1130638805 15:85650946-85650968 CTATGTGCCTTGGAAAATAATGG - Intronic
1131019533 15:89086936-89086958 CATGTTACCTTGAAAAAAAAAGG - Intergenic
1133723696 16:8518208-8518230 CTATTTAGCCTTAAAAATAAAGG + Intergenic
1137887894 16:52126356-52126378 ACATTTACCTTGGAAAATAATGG + Intergenic
1138780390 16:59778222-59778244 CTAGTTTCCTTGAAATTGAATGG - Intergenic
1138889108 16:61120259-61120281 CAAGTTATCTAGAAATATAAAGG - Intergenic
1138894962 16:61192452-61192474 ATAGTAACCTTGAAAAATACAGG - Intergenic
1140698642 16:77560525-77560547 CTAGTCACATTCAAACATAATGG - Intergenic
1143340793 17:6209312-6209334 TTAGTTTCATTGAAATATAATGG + Intergenic
1143828453 17:9631696-9631718 CTAGTTACCGTGGAGGATAAAGG + Intronic
1147048106 17:37769776-37769798 CTTGTGAACTTGAAAAACAAAGG + Intergenic
1148290078 17:46438306-46438328 CTAGATAACATGAAAAAAAAGGG - Intergenic
1148312246 17:46655878-46655900 CTAGATAACATGAAAAAAAAGGG - Intronic
1150415776 17:64987613-64987635 CTATTTACCTTGAAAAAATTAGG + Intergenic
1151040139 17:70850008-70850030 TTACTTTCATTGAAAAATAAAGG + Intergenic
1153204183 18:2679151-2679173 CAAGTAGCCTTCAAAAATAATGG - Intronic
1153592887 18:6692766-6692788 CTCTTTACCTTGGGAAATAAAGG - Intergenic
1155407830 18:25509785-25509807 CAAGTTATTTTGAAAAATAGAGG - Intergenic
1155468066 18:26161180-26161202 CTAGTTCCCAAGAAAAAGAAGGG - Intronic
1156145665 18:34174493-34174515 TCAGTAGCCTTGAAAAATAATGG + Intronic
1156440128 18:37177279-37177301 CTTGTCACCTTTAAAAATATTGG + Intronic
1157325033 18:46662823-46662845 CTAGTTACCTTGAGAAATAAGGG - Intergenic
1159071756 18:63631075-63631097 ATAGTTACCTTGAATATAAATGG + Intergenic
1159536245 18:69718581-69718603 CTATTTAGCTTAAAAAAGAAAGG + Intronic
1160332030 18:78002820-78002842 CTACTTATCTTAGAAAATAATGG + Intergenic
1164102214 19:22066576-22066598 CTATTTACATTTTAAAATAATGG - Intronic
1166621718 19:44306817-44306839 TTAGGTACCTTGAGGAATAATGG - Intergenic
926348817 2:11976422-11976444 CTTGTCACCTTGAAACAAAATGG - Intergenic
926758987 2:16260774-16260796 CTATTTACTTTAAAAACTAAAGG + Intergenic
927224617 2:20751212-20751234 CTTTTTACCTTTAAAAAGAAAGG - Intronic
927566188 2:24115193-24115215 CAAGCAACCTTGAAAAATGAAGG - Intronic
928010286 2:27601244-27601266 CTATTGAGCTTGAGAAATAAAGG + Intronic
928683218 2:33724278-33724300 ATGTTTACATTGAAAAATAAGGG - Intergenic
930546579 2:52774662-52774684 CTATTTACCTTGAAATTTTATGG + Intergenic
930797240 2:55406314-55406336 CCAGTTAACTTGAATAATTAGGG - Intronic
931797451 2:65724708-65724730 CTACTTACCTTGAAAATTATGGG + Intergenic
932259176 2:70312696-70312718 CTACTTACCTGGTAAAATCAAGG - Intergenic
935618045 2:105105367-105105389 CTGGTTTCCTTGAAAATGAATGG + Intergenic
937456027 2:122042476-122042498 ATATTTACTTTGAAAATTAAGGG - Intergenic
937925778 2:127166401-127166423 CCAGTTGCCATGAGAAATAAGGG - Intergenic
939218009 2:139265074-139265096 CTAGTTTCCTTGTAGAAAAATGG + Intergenic
939551906 2:143626335-143626357 CTTGTTGCCTTGAACAATGAAGG - Intronic
939833145 2:147096662-147096684 CCAGTTACTCTGAAAAAAAAAGG - Intergenic
940470630 2:154094698-154094720 ATATTTGCCTTTAAAAATAAAGG - Intronic
941878777 2:170461089-170461111 CTAGTTAATTTGAATAAAAAGGG + Intronic
942192461 2:173483666-173483688 ACAGTTACCATGAAAACTAAAGG - Intergenic
942906556 2:181188716-181188738 CTAGTTCCCCTGGAAAATAGTGG + Intergenic
943851023 2:192723053-192723075 AGAGTTACCTTGGAAAATCATGG + Intergenic
944709037 2:202319318-202319340 CTGGTGACCCTGAATAATAAGGG - Intergenic
944978593 2:205088462-205088484 TGAGTTGCTTTGAAAAATAATGG + Intronic
945076597 2:206046154-206046176 CTAGTTTTATTGTAAAATAAAGG - Intronic
945438856 2:209853693-209853715 CTATTTCACTTGAAAAATATAGG - Intronic
947321131 2:228920031-228920053 AGAGTGCCCTTGAAAAATAAGGG - Intronic
948118146 2:235509126-235509148 ATAGTTACCGTGAAAATTAATGG + Intronic
1170097293 20:12660372-12660394 CTAGATGCCTTGAAATATCATGG - Intergenic
1171327497 20:24308289-24308311 CAAGTCAACTTGAAAAATTAGGG + Intergenic
1172517712 20:35546739-35546761 ATAGTGAACTTGGAAAATAAGGG + Intronic
1176175003 20:63717275-63717297 CTGTATACCTTGAAAAATTAGGG - Intronic
1177219239 21:18169325-18169347 CTAGTTACCTTACAAAAATAAGG - Intronic
1177967993 21:27752475-27752497 CTTTTAACCTTGAAATATAAAGG + Intergenic
1180070430 21:45433283-45433305 CATGTTACCTATAAAAATAAAGG - Intronic
1181492593 22:23269782-23269804 CAAGTGACCTTGACAAATCAGGG + Intronic
1183614506 22:38935314-38935336 CTTGTGACCTTGTAAGATAAGGG + Intergenic
1184969764 22:48008366-48008388 CTAGTTACAATGTAAAATGATGG - Intergenic
950229349 3:11262677-11262699 TTATTTACCTTGAACAATCAAGG + Exonic
950912342 3:16607118-16607140 CTACTTACCTTGAATAAGAATGG + Intronic
951704233 3:25527665-25527687 CTTTTTACCTTAAAACATAAGGG - Intronic
953838500 3:46368608-46368630 CAAGTTAGTTTGAAAAATATAGG - Intergenic
956267294 3:67411430-67411452 TTAGTTTTCTGGAAAAATAAGGG + Intronic
958492180 3:94790819-94790841 TAAGTTACTTTGAAAAATAGTGG + Intergenic
959776440 3:110169935-110169957 CAGGATCCCTTGAAAAATAAAGG - Intergenic
960820685 3:121727560-121727582 CTTGTTGCCTTGAAGAATCAAGG + Intronic
964198610 3:154092215-154092237 CTAGGGACCTTGAAAATTGAAGG - Intergenic
964857662 3:161164561-161164583 CTGATTACCGTGAAAATTAAGGG + Intronic
964957957 3:162384698-162384720 CTAGGTACCATGAAATATAAAGG + Intergenic
965946760 3:174251999-174252021 CTATCTACCTTGAGAAAAAAAGG - Intronic
966152632 3:176881035-176881057 GTAGCTAGCTAGAAAAATAAAGG + Intergenic
967666086 3:192173910-192173932 TTAGTTACCTTGTTAGATAAAGG - Intronic
967767793 3:193300756-193300778 CTAGGTACCTTCAGGAATAAGGG + Intronic
971255014 4:25006369-25006391 CAAATTACCTAGAAAATTAAAGG - Intronic
971539821 4:27802104-27802126 CTAGTAAACTTTTAAAATAAGGG - Intergenic
971541720 4:27826399-27826421 CTAGTAACCTTAAAAAATGAAGG - Intergenic
973937286 4:55860195-55860217 GGAGATTCCTTGAAAAATAAAGG - Intronic
975056463 4:69938319-69938341 CTTTTTACCATTAAAAATAATGG + Intronic
975199356 4:71567265-71567287 CTAGTTACTATTACAAATAATGG + Intronic
976915811 4:90373548-90373570 CTAATTAAAATGAAAAATAATGG - Intronic
979744835 4:124199257-124199279 ATAGGTGCCTTGGAAAATAAAGG + Intergenic
980417154 4:132505433-132505455 CTATTTCCATTGTAAAATAAAGG + Intergenic
980635362 4:135495166-135495188 CAAATTGCCTTTAAAAATAAAGG + Intergenic
980876687 4:138668702-138668724 CAAATTGCCTTTAAAAATAATGG + Intergenic
981292494 4:143092418-143092440 CAAGTTAGCTTTAAAAATATTGG + Intergenic
981423223 4:144575260-144575282 CTAGCTTACTTGGAAAATAATGG + Intergenic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982471354 4:155794335-155794357 CTTGTTACAGTGAAAAAAAATGG + Intronic
985187012 4:187328384-187328406 GTAGATTCCTTGAGAAATAATGG + Intergenic
986192847 5:5512951-5512973 GTAGTTATTTTGGAAAATAATGG + Intergenic
986493664 5:8319686-8319708 GTATTTACCTTGAAAAATAGAGG + Intergenic
986902136 5:12449496-12449518 TTATTTATGTTGAAAAATAATGG - Intergenic
987646029 5:20673092-20673114 TTACTTACCTTGAGAAATAATGG + Intergenic
988180068 5:27779150-27779172 ATAGTCACTTCGAAAAATAAAGG - Intergenic
989159399 5:38375905-38375927 TTGGTGACCTTGAATAATAATGG + Intronic
989428147 5:41320209-41320231 CTAATTATTTTGAAAAATAGAGG + Intronic
990738878 5:58892303-58892325 CTTGTTTTATTGAAAAATAAAGG - Intergenic
991079887 5:62587341-62587363 CTAGCTCCCCTGAAAAATACTGG - Intronic
991430092 5:66535373-66535395 ATAGGTCCCTTGAAAAAGAATGG + Intergenic
991683555 5:69161675-69161697 GTAGTTTCCTTGAAATACAATGG + Intergenic
991687547 5:69195411-69195433 CAAGTTATTTGGAAAAATAAAGG - Intronic
992098826 5:73386556-73386578 CTTCTTACCTTTAAAATTAAGGG - Intergenic
992708360 5:79421905-79421927 CTATTTACATTGAAAAGTATTGG - Intronic
995916326 5:117249499-117249521 CTAGAAAGCTTGAAAAATTATGG + Intergenic
996860267 5:128057826-128057848 GTACTTTCCTTCAAAAATAAAGG + Intergenic
997272827 5:132556317-132556339 ATAGATATCTTTAAAAATAAGGG - Intronic
997571821 5:134934851-134934873 CTAGTTACCATGTAAATTTATGG - Intronic
998114728 5:139527577-139527599 ATGGTTATCTTCAAAAATAAAGG + Intronic
1000604137 5:163310313-163310335 ATGGTAACCTGGAAAAATAATGG + Intergenic
1004777042 6:18859187-18859209 TTAGTTAGCCTTAAAAATAAAGG - Intergenic
1004995012 6:21182469-21182491 CTAGTTACCTTAAATTTTAAGGG - Intronic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1009761148 6:68008287-68008309 CTAGTGCCCTAGAAAAATATCGG - Intergenic
1009763092 6:68034137-68034159 TTAATTTCCTTAAAAAATAATGG + Intergenic
1010127198 6:72446903-72446925 ATAGTTAACTTGAAAAAACAAGG + Intergenic
1010785610 6:79996601-79996623 CTAGTTACCATGATAGAGAATGG + Intergenic
1012031100 6:94065572-94065594 CTAAATATCTTGAAAAATTAAGG - Intergenic
1012686782 6:102260389-102260411 ATAGTTGCCATGATAAATAATGG - Intergenic
1014899632 6:126947205-126947227 CTAGTTTATTTGGAAAATAAAGG + Intergenic
1015420074 6:132997303-132997325 CTTGTTACCTTCAACCATAAAGG + Intergenic
1015741978 6:136466482-136466504 ATAGTTTCCATGAAAATTAAAGG - Intronic
1015917180 6:138229080-138229102 CTATGTATCTTGGAAAATAAGGG + Intronic
1016765389 6:147787242-147787264 CTCGTTAACTTGAAATAGAATGG + Intergenic
1018304930 6:162444937-162444959 CTTGTAACATTTAAAAATAATGG + Intronic
1019078270 6:169409263-169409285 CTAATAACCTGGTAAAATAATGG + Intergenic
1019156744 6:170044369-170044391 CTTGTTTTCTTGCAAAATAATGG - Intergenic
1020190506 7:5993513-5993535 CTATTTTCCTAGGAAAATAAGGG - Intronic
1026187483 7:68093255-68093277 CTAGTCACCTTAAGAAAGAAAGG - Intergenic
1027502989 7:78978773-78978795 CTAGGTAACTTGGGAAATAAGGG + Intronic
1027736763 7:81942222-81942244 CTGGTTATATTGAAAAAAAAAGG - Intergenic
1027909884 7:84236921-84236943 TTAATTACCTGGAAAAAAAATGG + Intronic
1027967845 7:85036693-85036715 TTAGTTACTTTGAGAAACAATGG - Intronic
1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG + Intronic
1028624878 7:92866338-92866360 ATAGTAAGCATGAAAAATAAAGG + Intergenic
1028879451 7:95863645-95863667 CTAGTTACCTTGAAAAATAAAGG - Intronic
1030444423 7:109631507-109631529 TTACATACCTTGAAAAATAATGG + Intergenic
1030474292 7:110009658-110009680 CTAGAAATCTTGAAAAATACTGG - Intergenic
1030670304 7:112328205-112328227 CAAGTTACAGTGAAAAGTAAAGG - Intronic
1031819677 7:126484547-126484569 GTAGTTACATTTAAAAATGAGGG - Intronic
1031871593 7:127093983-127094005 ATAGTTTCCTTGAAAATAAATGG - Intronic
1033269971 7:139921990-139922012 ATAGTTACAGTGAAAAATAATGG - Intronic
1033463959 7:141573945-141573967 CTATTTACATTTAAAAAAAAAGG - Intronic
1036012378 8:4741144-4741166 CTAGTGTGCTTGAAAAAGAAGGG - Intronic
1038047415 8:23777513-23777535 GTGGTCACCTTGGAAAATAAAGG + Intergenic
1038933496 8:32221112-32221134 TTAGCTACTTTAAAAAATAAAGG + Intronic
1039041312 8:33411090-33411112 CTAGTGATCAGGAAAAATAATGG + Intronic
1039043597 8:33430475-33430497 TTAGTCACCTTGAGAAAAAAGGG + Intronic
1042852557 8:73230766-73230788 TTAGTAATTTTGAAAAATAATGG - Intergenic
1046355272 8:113075677-113075699 ATAGTTACCCTGAATAATATAGG - Intronic
1047719440 8:127626019-127626041 CTAGCTACCTTGAAGGCTAAGGG - Intergenic
1051075858 9:13235169-13235191 TTAATTAGCTTTAAAAATAAGGG - Intronic
1051590657 9:18774083-18774105 CACGTTAACTTGAAAAATGATGG - Intronic
1052442617 9:28517082-28517104 TTAATCACCTTGAAAAATTAAGG - Intronic
1053412646 9:37925575-37925597 CAAGTTCCCTTGCAAAATCATGG + Intronic
1055751527 9:79511735-79511757 CTAGTCAGCAAGAAAAATAAAGG - Intergenic
1057102337 9:92374486-92374508 CTGGTTACCTTGAGAATTACAGG + Intronic
1058181437 9:101805031-101805053 TTGATTACATTGAAAAATAATGG - Intergenic
1061596883 9:131636440-131636462 CCAGTCACTTTGAAAAATCAAGG + Intronic
1187391643 X:18890230-18890252 TAAGTCACCTTGAAAGATAATGG + Intergenic
1187434345 X:19253345-19253367 CAAGTTAACTTAAAAAATGATGG + Intergenic
1188205603 X:27353984-27354006 CAAGTGACCTTCAAAAATAGTGG - Intergenic
1188798899 X:34502387-34502409 CTAGTTAATTTTAAAGATAACGG + Intergenic
1189584870 X:42448800-42448822 CTAATTTGCTTGAAAAATGATGG - Intergenic
1190040852 X:47070915-47070937 CTTATTGCCATGAAAAATAATGG - Intergenic
1192829780 X:74739954-74739976 CTTTTTACTTTGAAAAAGAAGGG + Intronic
1193032692 X:76916543-76916565 ATAGTAACCTTGAAACATTAAGG - Intergenic
1193619909 X:83738712-83738734 CTTGTCACCCTGAAAAAAAAAGG + Intergenic
1193642282 X:84024782-84024804 AAACATACCTTGAAAAATAAGGG - Intergenic
1194107231 X:89785705-89785727 ATTGTTACCTTGAAAATAAAGGG - Intergenic
1195523946 X:105864268-105864290 CTAGTTACCCTGAAAACATAGGG + Intronic
1197158319 X:123294513-123294535 CTACATACCATCAAAAATAATGG - Intronic
1197381590 X:125749127-125749149 ATAGTTGCTTTGAAGAATAAGGG + Intergenic
1197907475 X:131441759-131441781 CTTGTTACCATGAAAAAATAAGG + Intergenic
1200459186 Y:3433541-3433563 ATTGTTACCTTGAAAATAAAGGG - Intergenic
1202282177 Y:23200667-23200689 CTACTTATCTTGAATAAGAATGG + Intergenic
1202283714 Y:23217852-23217874 CTACTTATCTTGAATAAGAATGG - Intergenic
1202433849 Y:24815052-24815074 CTACTTATCTTGAATAAGAATGG + Intergenic
1202435390 Y:24832238-24832260 CTACTTATCTTGAATAAGAATGG - Intergenic