ID: 1028880775

View in Genome Browser
Species Human (GRCh38)
Location 7:95877249-95877271
Sequence TCAGCCCAACACTAACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028880768_1028880775 15 Left 1028880768 7:95877211-95877233 CCAAGCAAGTGTGAGTACAAGGT 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1028880775 7:95877249-95877271 TCAGCCCAACACTAACTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028880775 Original CRISPR TCAGCCCAACACTAACTTGA GGG Intronic
No off target data available for this crispr