ID: 1028884129

View in Genome Browser
Species Human (GRCh38)
Location 7:95912380-95912402
Sequence CTGGAGTGAAGGAGTTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028884121_1028884129 27 Left 1028884121 7:95912330-95912352 CCTGGCCCACTTGAACATCTTGA 0: 1
1: 0
2: 1
3: 30
4: 206
Right 1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1028884122_1028884129 22 Left 1028884122 7:95912335-95912357 CCCACTTGAACATCTTGATGCTA 0: 1
1: 0
2: 1
3: 16
4: 106
Right 1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1028884123_1028884129 21 Left 1028884123 7:95912336-95912358 CCACTTGAACATCTTGATGCTAA 0: 1
1: 0
2: 0
3: 25
4: 300
Right 1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG 0: 1
1: 0
2: 3
3: 18
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028884129 Original CRISPR CTGGAGTGAAGGAGTTTATC TGG Intronic
906565683 1:46799414-46799436 CTGGAGTGAAGGAGAAATTCCGG - Intronic
912866816 1:113264952-113264974 CTGGTGTGAAGGACCTTATGTGG - Intergenic
915955846 1:160219285-160219307 CTGGAGTGAATGAGGTCATCTGG - Intronic
916803190 1:168233308-168233330 CTGGAGAGGAGGAGGTAATCAGG - Intronic
917784213 1:178435159-178435181 CTGGAGTCCAGGATTTTATGTGG + Intronic
920858408 1:209683799-209683821 CTGGGGTGAAAGATTTTGTCAGG + Intergenic
921774781 1:219084395-219084417 CTGGAGTGAAGTGGGTTAACAGG - Intergenic
1063232648 10:4080870-4080892 CTGGGTTGAAGGAGGTCATCAGG - Intergenic
1064980648 10:21163127-21163149 CTGGAGAGAAGGAGGTTAAATGG + Intronic
1067793050 10:49302039-49302061 CTGGAGGGAAGGATTTCATCTGG + Intronic
1067933138 10:50583453-50583475 CTGGAGTGAAGCACATGATCTGG + Intronic
1069934583 10:71906366-71906388 CTTGGGTGCAAGAGTTTATCGGG - Intergenic
1073092444 10:100953511-100953533 CTGGATTGTAGGAGTCTTTCAGG - Intronic
1073235403 10:102010856-102010878 TTGGAGTTAAAGAGTTTATCAGG + Intronic
1073255121 10:102146096-102146118 CTGGAGTGTAGTAGCTGATCAGG + Intronic
1075582614 10:123633774-123633796 CTTGAGCTAAGGAGTTTGTCAGG + Intergenic
1076735778 10:132458304-132458326 CTGGCGTCAAGGAGGTTTTCAGG - Intergenic
1079323807 11:19474586-19474608 ATGGAGTGAAGGAGTGGATGAGG + Intronic
1080691760 11:34564472-34564494 CTTGAGTGAAGAAATTCATCAGG - Intergenic
1080913448 11:36629139-36629161 GTGGAGTGAAGTAGTTTGGCTGG + Intronic
1081612944 11:44574051-44574073 CTGGAGTGAGGGAGCTTTCCGGG + Intronic
1083484048 11:62971865-62971887 CTGGGGTGCAGGATTCTATCGGG + Intronic
1084569458 11:69950660-69950682 CTGGAGAGAAGGAGATTGTCAGG + Intergenic
1085362325 11:75901404-75901426 CTAGACTGGAGGTGTTTATCTGG - Intronic
1087392657 11:97557693-97557715 CTGGAGTAAATAAGTTTTTCAGG + Intergenic
1090540509 11:127698192-127698214 GAGGAGTGAAGGAGATTCTCAGG - Intergenic
1093380460 12:18485157-18485179 CTGGATTGAATGAGTTTATGAGG + Intronic
1094502434 12:31033335-31033357 CTGGAGTCAAGGAGGCTTTCAGG + Intergenic
1095040948 12:37440095-37440117 CTGTAGTGAAGGCTTTTATAGGG + Intergenic
1095323264 12:40856469-40856491 CTGGAGATAATGAGTTTATAGGG + Intronic
1097766469 12:63532581-63532603 CTAGAGTGAAACAGTTTTTCTGG + Intergenic
1099244667 12:80180493-80180515 CTGCAGTGAAGGAGTCTGTGGGG + Intergenic
1099257351 12:80330140-80330162 GTGGAGTGGAAGAGATTATCGGG + Intronic
1100113365 12:91272520-91272542 CAGGAGTGAAGGAATGTTTCAGG - Intergenic
1100647105 12:96543240-96543262 TTTGAGTGAAGTAGTTTATTTGG + Intronic
1100814883 12:98376877-98376899 CTGGAGAAAAGGAGTCTATGGGG + Intergenic
1102078725 12:110080675-110080697 CTGGTGTTAAGGAGTCTGTCTGG + Intergenic
1105815697 13:24034265-24034287 GTTGAGCGAAGGAGATTATCAGG - Intronic
1106735394 13:32583823-32583845 CTGGAGTGCAGAAGTTTGACAGG - Intergenic
1106738187 13:32609634-32609656 CTGGAATGTAGGAGTTCCTCTGG - Intronic
1106808258 13:33333522-33333544 CTGGAGGGTAGGAGTTTATCTGG + Intronic
1108821620 13:54357690-54357712 GTGGACTGAAGGAGTTTTTCAGG - Intergenic
1114281954 14:21201281-21201303 CTTGAGTGCAGTAGTTTATTTGG - Intergenic
1114391415 14:22312473-22312495 CTGGAGTGCAGGAGTGTATGTGG + Intergenic
1114402067 14:22419227-22419249 CTGGAGAGATGGAGATTATGGGG + Intergenic
1123578903 15:21698553-21698575 CTTTAGTGAAGGAGTTTCTGAGG + Intergenic
1123615530 15:22141035-22141057 CTTTAGTGAAGGAGTTTCTGAGG + Intergenic
1127336258 15:57987832-57987854 CTGGAGTGCAGTAGTTGCTCAGG - Intronic
1130988099 15:88857834-88857856 CTGGAGTGACTGAGCTTAGCGGG + Exonic
1202987773 15_KI270727v1_random:432798-432820 CTTTAGTGAAGGAGTTTCTGAGG + Intergenic
1133460116 16:5980252-5980274 CTGGAGGGAAGGAGTCGATTTGG - Intergenic
1135882243 16:26269174-26269196 TTGGAGGGGAGGAGCTTATCTGG + Intergenic
1137722374 16:50634953-50634975 CTGCAGAGAAGGATTTTGTCTGG + Exonic
1139689332 16:68629844-68629866 GTGGAATGGAGGACTTTATCAGG + Intergenic
1140792705 16:78407686-78407708 CTGGAGGGAAGAAGTTGATGTGG - Intronic
1142137164 16:88456730-88456752 CGGGAGTGATGGAGTTGGTCAGG + Intronic
1144520598 17:15950123-15950145 CTTGAGAGAAGGAGCTTATTTGG + Intronic
1147899219 17:43773052-43773074 CTGGAGTGGAGGAGGTGAGCAGG + Intronic
1149779558 17:59386556-59386578 CTGGAGTGAAGGACATAATGGGG + Intronic
1150196664 17:63305854-63305876 CTGGATTGGAGCAGTTTGTCAGG + Intronic
1151179445 17:72315968-72315990 CTGGAGGGAAGGAGTTGAACAGG - Intergenic
1153132672 18:1874887-1874909 CTCGACAGAAGGAGTTGATCCGG + Intergenic
1157239243 18:45994062-45994084 CTGGAATGAATGAGTTTGACTGG + Intronic
1157764994 18:50289420-50289442 CTGCAATGCAGGAGTTTATTGGG - Intergenic
1157805374 18:50654060-50654082 ATGGAGTGAAGTAGTATATACGG + Intronic
1158379171 18:56909294-56909316 GTGGAGTGAGGGAATATATCTGG + Intronic
1159406177 18:68005707-68005729 AGGGGGTGAAGGGGTTTATCTGG - Intergenic
1159580187 18:70226677-70226699 CTGAAATCAAGGAGTTTCTCAGG - Intergenic
1160048357 18:75408383-75408405 CTGGAGGGTAGGTGTTGATCAGG - Intronic
1160381587 18:78461126-78461148 CTAGAGTTAAGGTCTTTATCTGG - Intergenic
925219674 2:2128195-2128217 CTGGAGTGCAGTAGTGTATTTGG + Intronic
926855563 2:17252194-17252216 CTTGAGTGAAGGAGTGAATATGG - Intergenic
930408970 2:50999387-50999409 CAGGAATGAAGGTGTTTATATGG + Intronic
931615840 2:64156731-64156753 CTGGACTGAAGAACATTATCAGG + Intergenic
933897137 2:86821850-86821872 CTGGAGCGAAGGAATTAACCAGG - Intronic
933979934 2:87541093-87541115 CTGGAGTGATGGACTTTAAGTGG - Intergenic
935719471 2:105967332-105967354 CTGCAGAGAAGGAGTTTATGGGG - Intergenic
936313887 2:111409698-111409720 CTGGAGTGATGGACTTTAAGTGG + Intergenic
938692839 2:133808091-133808113 GGGGAGGGAAAGAGTTTATCAGG - Intergenic
943661017 2:190559497-190559519 CTGAAGTGAAGGTGTTCTTCAGG - Intergenic
946436341 2:219658414-219658436 CTGTAGGGAATGTGTTTATCTGG - Intergenic
946681071 2:222216532-222216554 CTGGTGTGAAGCAGTGTCTCAGG - Intronic
947218608 2:227771669-227771691 ATGAAGTGAAGGATTTTGTCAGG + Intergenic
948874089 2:240818243-240818265 CCGGAGTGAAGCTGTTCATCCGG + Intronic
1168979944 20:1995830-1995852 CTGGAGGGATGTGGTTTATCAGG - Intergenic
1169269475 20:4188033-4188055 CTGGAGTGAAGGAGTTCTGTGGG + Intergenic
1171935821 20:31274208-31274230 CTGCAGTGAAGGAGGTCACCAGG - Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173195129 20:40907987-40908009 TTGGAGTGTAGGAGTTGAGCAGG - Intergenic
1178322184 21:31614112-31614134 CTGGATTGGATGAGTTTGTCAGG - Intergenic
949714182 3:6909436-6909458 CTGTCCTGAAGGAGTTTATAGGG - Intronic
956977000 3:74592313-74592335 GTGGAGTAAAGGAGTTTAACAGG + Intergenic
957977782 3:87469800-87469822 CTGAAGTGAAGGAGTTTTGCTGG - Intergenic
959867385 3:111286249-111286271 TTCGAGTGAAGGAGTTAATTAGG - Intergenic
961804035 3:129476038-129476060 CAGGAGTGCAGGAGTGTGTCAGG - Intronic
964404504 3:156334947-156334969 CTGGAGTCAAGGAAATGATCAGG - Intronic
964488572 3:157210314-157210336 CTAGAGTAAAGGAGTTTGCCGGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
966086167 3:176068948-176068970 CAGGGGTGGAGGAGCTTATCGGG + Intergenic
967221988 3:187255114-187255136 CTAAAGTGAGGGAGATTATCTGG + Intronic
967389275 3:188939512-188939534 CTGGAGAGAAGGATATTATTAGG - Intergenic
970436183 4:16037641-16037663 CTGGTTTGAAGGCGGTTATCGGG - Intronic
972886928 4:43503861-43503883 ATGGGGTAAAGGAGTTTATAAGG - Intergenic
974875331 4:67697381-67697403 TAGGATTGAATGAGTTTATCTGG - Intronic
975397813 4:73897617-73897639 CTTGAGTCAAGGATTTAATCTGG - Intergenic
976400681 4:84603321-84603343 CTGGAGTGAGGGTGTTGAACTGG - Intronic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
977742330 4:100501829-100501851 CTAGAATTAAAGAGTTTATCAGG - Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
987994958 5:25264491-25264513 CTGGAGTGATGGAGGTTCTTCGG - Intergenic
988525551 5:31983981-31984003 ATGCAGTGAAGTACTTTATCTGG - Intronic
988741749 5:34081714-34081736 CTCTAGTGAAGCAGTTTTTCCGG + Intronic
989342796 5:40395307-40395329 CGGGAGACAAGGAGTTTACCTGG + Intergenic
991662232 5:68962005-68962027 CTGCAGGGAAGGAGTTGTTCTGG + Intergenic
999704798 5:154262471-154262493 CTTGAGTGATGGAGTTAATTGGG - Intronic
1000643900 5:163738207-163738229 CTGGAGCAAAGGAGTTTATCAGG + Intergenic
1002389556 5:178899045-178899067 CTGGAGTGAAGGGGAGGATCAGG + Intronic
1003094054 6:3128613-3128635 ATGGAGTGAAGCAGGGTATCTGG - Intronic
1003857815 6:10293772-10293794 CTGGAGTGGAGGACTCTAGCTGG + Intergenic
1008068375 6:47074502-47074524 CTGCAGTGAAGCAGATTAACAGG - Intergenic
1009433032 6:63587586-63587608 ATGGGGGGAAGGAGTGTATCAGG + Intergenic
1010462997 6:76134289-76134311 CTGGAGTGAGGGAGTAAATTAGG - Intergenic
1010516857 6:76784042-76784064 CTGGAATCAAGGAGATGATCTGG - Intergenic
1012114674 6:95281206-95281228 CTGGGCTGAAGGAGTTTCTCAGG - Intergenic
1013506012 6:110801077-110801099 CTGTACTGAAGTCGTTTATCGGG - Intronic
1014722763 6:124938268-124938290 CTGAAATGTAGGAGGTTATCAGG + Intergenic
1015075590 6:129152803-129152825 CTTGAATGAAGGTATTTATCAGG - Intronic
1024120301 7:46230025-46230047 GTGGAGAGAAGGACTTTATGTGG - Intergenic
1024829469 7:53432683-53432705 CTGGAGTGAAGGAGTACAGACGG + Intergenic
1025200158 7:56956911-56956933 CTGCTGTGAAGGAGGTTATGGGG + Intergenic
1025671787 7:63620021-63620043 CTGCTGTGAAGGAGGTTATGGGG - Intergenic
1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG + Intronic
1030392836 7:108948244-108948266 CTGGACTGAAGGAATTGCTCAGG + Intergenic
1030887142 7:114952142-114952164 CAGGAAAGAAGGAGTTTTTCTGG + Intronic
1032566553 7:132953144-132953166 GTGGAGTGAAGGACTCTATAAGG - Intronic
1033794778 7:144834510-144834532 ATGGAATGAATGAGTTTATGAGG - Intronic
1034205822 7:149314062-149314084 CTTTACTGAAGTAGTTTATCAGG + Intergenic
1037762137 8:21748576-21748598 CTGGAAAGAAGCAGTTTAGCTGG + Intronic
1040124450 8:43721008-43721030 CTGTAGTGGAAGAGTTTATGGGG - Intergenic
1040480443 8:47821603-47821625 CTGGAGTGAACCATTTTATCAGG - Exonic
1040863715 8:52026508-52026530 CTTGAGTCCAGGAGTTTGTCTGG + Intergenic
1042392955 8:68256904-68256926 CTGGAATGAATGTGTTTTTCTGG + Intergenic
1043765296 8:84123327-84123349 ATGGCCTGAATGAGTTTATCAGG - Intergenic
1044175003 8:89108949-89108971 CTGCAGTGGAGGAGATTATTAGG - Intergenic
1044320218 8:90792563-90792585 TTGGAGAGAAGGAGAATATCAGG - Intronic
1047285655 8:123485195-123485217 TTGGAGGGAAAGAGTTTACCAGG + Intergenic
1058179386 9:101778670-101778692 CTGCAGTTAAGGAATTAATCCGG - Intergenic
1058363722 9:104182367-104182389 CTGGAGTGAAAATATTTATCAGG + Intergenic
1059818103 9:117940798-117940820 CTGCTTTGAAGGAGTTTTTCTGG - Intergenic
1059861935 9:118474284-118474306 ATGAAGAGAAGGAGTTTATCAGG + Intergenic
1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG + Intergenic
1062127180 9:134870108-134870130 CTGGCCTGAAGGAGTTAATGTGG + Intergenic
1062136754 9:134933182-134933204 CTGGAGTCAGGGAGTTTATCTGG - Intergenic
1062639256 9:137509306-137509328 CTGGTGTGAGTGAGTTTAGCTGG + Intronic
1062639264 9:137509439-137509461 CTGGTATGAATGAGTTTAGCTGG + Intronic
1062639271 9:137509553-137509575 CTGGTGTGAGTGAGTTTAACTGG + Intronic
1062639272 9:137509572-137509594 CTGGTGTGAGTGAGTTTAGCTGG + Intronic
1062639274 9:137509629-137509651 CTGGCGTGAATGAGTTTAGCTGG + Intronic
1188182032 X:27067678-27067700 CTGGAGTGATGCAGTTTTGCAGG + Intergenic
1189804880 X:44725338-44725360 CAGGAGTTAAGGAGTTAATCAGG - Intergenic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1193141049 X:78027234-78027256 CTTTACTGAAGTAGTTTATCTGG - Intronic
1193800431 X:85929191-85929213 GTTGAGTGAGGGAGTTAATCAGG - Intronic
1194013775 X:88594098-88594120 CTGTAGTGAAGTTGTTTATTAGG + Intergenic
1198094399 X:133364370-133364392 CTGGAGTGAAGAATTCCATCTGG + Intronic
1199109222 X:143910505-143910527 ATGGAGATGAGGAGTTTATCGGG - Intergenic
1201722416 Y:17114514-17114536 CTGGAGTGAAGAATTTTATGAGG + Intergenic
1202337382 Y:23826204-23826226 CTGAAGAGAAGGAATGTATCTGG - Intergenic
1202533384 Y:25843867-25843889 CTGAAGAGAAGGAATGTATCTGG + Intergenic