ID: 1028885499

View in Genome Browser
Species Human (GRCh38)
Location 7:95928251-95928273
Sequence GGAGGCCAAGTCCTCATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028885494_1028885499 13 Left 1028885494 7:95928215-95928237 CCCTGACATTGCTGTTAAATTGT 0: 1
1: 0
2: 1
3: 16
4: 285
Right 1028885499 7:95928251-95928273 GGAGGCCAAGTCCTCATTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 144
1028885495_1028885499 12 Left 1028885495 7:95928216-95928238 CCTGACATTGCTGTTAAATTGTA 0: 1
1: 0
2: 0
3: 13
4: 183
Right 1028885499 7:95928251-95928273 GGAGGCCAAGTCCTCATTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028885499 Original CRISPR GGAGGCCAAGTCCTCATTTC TGG Intronic
900592016 1:3464340-3464362 GGGGGCCAGGCCTTCATTTCAGG + Intronic
900708284 1:4094244-4094266 GGATGCCCTGTCTTCATTTCTGG - Intergenic
900767311 1:4513998-4514020 GGAGGCCAGCTCCTCATGCCAGG - Intergenic
901894689 1:12300833-12300855 GAATGACAAGGCCTCATTTCTGG - Intronic
904096702 1:27984270-27984292 GGAGGCCAAGGCATCACTTGAGG - Intronic
906062597 1:42958373-42958395 GGAGGCCATGTGCTCAGTGCCGG + Intronic
908027351 1:59967047-59967069 GGAGGCCAAGGTCATATTTCAGG - Intergenic
908729850 1:67214855-67214877 GCAGGCCCAGTCCTGGTTTCGGG - Intronic
910261070 1:85294351-85294373 GGAGACCAAGTCTTCAATCCTGG - Intergenic
911263728 1:95718387-95718409 GGATCCCAAGCCCTCACTTCAGG - Intergenic
917475090 1:175362558-175362580 GGAGGCTAAGGCTCCATTTCGGG - Intronic
918743186 1:188163168-188163190 GGCACCCAAGTCTTCATTTCAGG + Intergenic
918978941 1:191529627-191529649 GGAAGCCAAGGCCACATTTTGGG + Intergenic
919849541 1:201663413-201663435 ACTGGCCATGTCCTCATTTCTGG + Intronic
922183267 1:223252861-223252883 GGAGGCCAAGGCCTGAGGTCAGG + Intronic
922446768 1:225704490-225704512 AGAGGCCAAGGCCTCACTTTGGG - Intergenic
922694118 1:227719303-227719325 GCAGGCCCAGGCCTCATTTCAGG - Intergenic
923304117 1:232672657-232672679 GGAGACGAAGAGCTCATTTCTGG - Intergenic
924536373 1:244939271-244939293 GGTGGCCAAGACCTCTTTCCAGG + Intergenic
1063059492 10:2536727-2536749 GGAGGCCAAGTGCTAAGATCAGG + Intergenic
1063934619 10:11064919-11064941 GCAGGCCCAGTCTCCATTTCAGG + Intronic
1067308038 10:45084077-45084099 GGATGCCATGTTTTCATTTCTGG + Intergenic
1067395733 10:45915241-45915263 GGAGGCCAAGGCATCATCTGAGG + Intergenic
1067725255 10:48765679-48765701 GGAGGTCCAGTCCTCAGGTCAGG - Intronic
1067864055 10:49884364-49884386 GGAGGCCAAGGCATCATCTGAGG + Intronic
1071446389 10:85752257-85752279 TGAGTGCAAGTCATCATTTCTGG - Intronic
1072425567 10:95327468-95327490 GGAGGCTAAGATCTGATTTCTGG - Intronic
1073471932 10:103727805-103727827 GGAGGGCTCGTCCTGATTTCAGG + Intronic
1074330681 10:112505262-112505284 GGAAGAAAAGTCCTCATTTAAGG - Intronic
1075036860 10:119076701-119076723 GGAGGCCAAGGCATCACTTGCGG + Intronic
1075127302 10:119710828-119710850 GGAGGCCAAGTCCAAAATTAAGG - Intergenic
1077194127 11:1270790-1270812 GAAGGCCAGGTCCTGAGTTCTGG - Intergenic
1077264596 11:1642468-1642490 GGAGGCCAGGTCCTCGGTCCCGG - Intergenic
1083549943 11:63580254-63580276 GGTGTCCATGTCCTAATTTCAGG + Intronic
1085998477 11:81951319-81951341 GCAGGCCCAGGCCTGATTTCGGG - Intergenic
1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG + Intronic
1089388718 11:118085614-118085636 GGATGGCAGGTCCTCAGTTCAGG + Intronic
1093937800 12:25019687-25019709 GGATGCGAAGTTCTCATTTAAGG + Intergenic
1096530336 12:52238629-52238651 GGAGACCATGTCCTCAGTACAGG - Intronic
1100553818 12:95672542-95672564 AGGCGCCAAGTCCTCATTACAGG - Intronic
1102570549 12:113824684-113824706 GGAAACCAAGTCTTCATCTCTGG - Intronic
1103421728 12:120790552-120790574 GGTGGAGAAGTCGTCATTTCAGG - Intronic
1105645262 13:22311399-22311421 GGAGGCCAAGTCCTAAATCCAGG - Intergenic
1105805711 13:23950693-23950715 GGAAGCCAAGTCCTCTCTCCTGG + Intergenic
1105877671 13:24573301-24573323 GCAGGCCAAATCCTCAACTCTGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108635782 13:52333373-52333395 AGAGGCCAAATCCTCAACTCTGG + Intergenic
1108652025 13:52489875-52489897 AGAGGCCAAATCCTCAACTCTGG - Intergenic
1108676069 13:52739095-52739117 GGAGCCGTGGTCCTCATTTCGGG - Exonic
1109327812 13:60890523-60890545 GAAGACCAAGAGCTCATTTCTGG + Intergenic
1119667401 14:76494840-76494862 GGAGGTCAAGCCCTCTATTCTGG + Intronic
1120723005 14:87907599-87907621 GGAGGCAAGGCCCTCATATCTGG - Intronic
1122211136 14:100174904-100174926 GAAGGACAAGTCATCAGTTCAGG - Intergenic
1124040773 15:26101065-26101087 GCAGGCCAAGTCTCCACTTCAGG + Intergenic
1124041289 15:26106858-26106880 GCAGGCCAAGTCTCCACTTCAGG - Intergenic
1129693143 15:77724964-77724986 GGAGGCCAGGCCTTCATCTCAGG - Intronic
1130926063 15:88386728-88386750 GGATGCCAATTTCTCATGTCTGG - Intergenic
1131671483 15:94624470-94624492 GGAGGGCAAGTCCAGAGTTCAGG + Intergenic
1131871106 15:96765404-96765426 GCAGGAGAAGTCCTCAGTTCTGG + Intergenic
1132789362 16:1676935-1676957 AGAGGCCGTGGCCTCATTTCTGG + Exonic
1133900965 16:9974280-9974302 GCAGGCCCAGGCCTGATTTCGGG - Intronic
1136116726 16:28099243-28099265 GGAGGTCAGGGCCTCACTTCTGG - Intronic
1137670233 16:50274361-50274383 GGAGCCCAAGACCCCATTCCCGG - Intronic
1138560353 16:57797563-57797585 GGGGTCCATGTGCTCATTTCAGG - Intronic
1147048383 17:37771851-37771873 GGAGTTCAAGACCCCATTTCTGG - Intergenic
1149441025 17:56673964-56673986 GGAGGCCCAGGCCTCATTGCAGG - Intergenic
1149606269 17:57927246-57927268 GGAGGTGAAGCCCTCATTCCAGG + Intronic
1152310937 17:79549358-79549380 GGAGGCCATCTGCTCATTCCTGG - Intergenic
1153394196 18:4599451-4599473 GGAGCCCAAGTCTGCTTTTCAGG - Intergenic
1156163320 18:34386613-34386635 GGAAGCCAAGTTCTCAATCCTGG - Intergenic
1156338272 18:36188143-36188165 GGAGGCCAAGGCCTCTTGGCCGG + Intronic
1156450780 18:37265528-37265550 AGAGGCCAAGTCCACACCTCAGG - Intronic
1158438865 18:57455733-57455755 GGAGGACCAGTCCTCACTGCAGG - Intronic
1158861002 18:61592368-61592390 GATGTCCAAATCCTCATTTCTGG - Intergenic
1159123362 18:64195548-64195570 GGAGGCCAGGTCTGAATTTCAGG - Intergenic
1160127421 18:76189340-76189362 GGAGGTGAAGTTCTCATTTAGGG - Intergenic
1161713286 19:5861991-5862013 GGGGGCCAAGTCCACACTCCAGG + Intergenic
1163414938 19:17180737-17180759 GCTGGCCCAGTCCCCATTTCTGG + Intronic
1165152160 19:33767166-33767188 GGAGGCCAAGGGCTCATTCGAGG + Intronic
1167016073 19:46841951-46841973 GGAGGCCAAGGCTTGATCTCAGG + Intronic
1168129110 19:54306096-54306118 GGAGGCCAGTCCCTCAGTTCGGG - Intergenic
1168715991 19:58527710-58527732 GGTGGCCAAGGCCTCAGTCCAGG + Intronic
925705146 2:6677572-6677594 GGAGGCCCAGCCCCCTTTTCAGG - Intergenic
928401779 2:30984241-30984263 TCAGGCCAAGTTCTCATATCAGG + Intronic
932146814 2:69327738-69327760 GGAGACCAAGACCTCAGTTCTGG + Intronic
936574481 2:113641865-113641887 GTAGGTCAGGTCCACATTTCGGG + Intronic
937200670 2:120202579-120202601 GGAGGCCAAGTTCTTTCTTCAGG + Intergenic
940105822 2:150098890-150098912 GGAGAGGAAGTCCTCATTTCAGG - Intergenic
941752718 2:169150052-169150074 TGAGGACAAGTCCTCACTACAGG + Intronic
941795517 2:169594858-169594880 GGAGGCCAAGGCATCACTTGAGG - Intronic
944566429 2:200996255-200996277 GGAGGCCAAGGCCTGAGGTCAGG - Intronic
944795774 2:203183842-203183864 GGAGGCCAAGGCCTCACCTGAGG + Intronic
946355876 2:219184286-219184308 GGAGGCCATCTGCTCAGTTCTGG - Exonic
948281781 2:236752636-236752658 GGAGGCCAGCTCCTCACTCCTGG - Intergenic
1168789419 20:566217-566239 GAAGGACATGTCCTCACTTCTGG + Intergenic
1168996506 20:2137054-2137076 TGAGGCCAAGGCATCTTTTCTGG + Intronic
1170481426 20:16768715-16768737 TGTGCCCAAGTCCTTATTTCAGG + Intronic
1172358280 20:34294706-34294728 GGAGGTCTAGTACTCATCTCAGG - Intronic
1173702147 20:45082096-45082118 GGAGGCCAAGAACTCATTTGAGG + Intergenic
1175804539 20:61820224-61820246 GGATGCCAAGTTCTCATGCCAGG - Intronic
1177174605 21:17690224-17690246 AGATGTCAAGTCCTCATGTCAGG + Intergenic
1181753200 22:25004346-25004368 GGAGGCCAAGGCCTCACTTGAGG - Intronic
1182193327 22:28487792-28487814 TAAAGCCAAGTCCTCATTTTTGG + Intronic
1185425689 22:50769018-50769040 GTAGGTCAGGTCCACATTTCGGG - Intronic
956110281 3:65863493-65863515 TGAGGCCAAGTAGTCATTTCTGG - Intronic
956970716 3:74522052-74522074 GGAGGCCAAGTTCTCTCTTTGGG - Intergenic
964453179 3:156832225-156832247 GGAGAGAAAGTCCTCACTTCAGG + Intronic
969166363 4:5319246-5319268 GGAGGCAAAGTCCTAGGTTCTGG - Intronic
969227782 4:5810402-5810424 GGAGGCAAGGTCCTCATTGTTGG - Exonic
969351418 4:6600137-6600159 AGAGGCCAGGTCCTCATCACAGG + Intronic
970332960 4:15003560-15003582 GGAGGCCAAGCCCGCATTGGGGG - Exonic
972788177 4:42346477-42346499 GGGGGCCAGGCTCTCATTTCTGG + Intergenic
977281479 4:95045359-95045381 GGAAGCAATGTCTTCATTTCTGG - Intronic
979439944 4:120739738-120739760 GGACCCAAAGTCCTTATTTCAGG + Intronic
981730015 4:147887288-147887310 GGAGGCCAACTCCTCTGTTCAGG + Intronic
983824963 4:172248509-172248531 GGAGGTAAAGTCCTCATGCCAGG + Intronic
986379091 5:7165151-7165173 GCAGGCCAAGTCCTGCTTCCAGG + Intergenic
988481025 5:31630714-31630736 GGAGGCCATGTCTTCATTGAAGG + Intergenic
997674108 5:135700142-135700164 GGAGGCCAACTCCTGAGGTCAGG + Intergenic
999101245 5:149027817-149027839 GGAGGCCAGGGCCTGCTTTCTGG - Exonic
1003815616 6:9837023-9837045 GAGGACCAAGTCCTCAGTTCAGG + Intronic
1004872914 6:19925343-19925365 GGAGGCCAAATCCTCATGAATGG - Intergenic
1008051854 6:46908376-46908398 GGAGGCAAAGTAGTCTTTTCAGG + Intronic
1014514733 6:122365158-122365180 ACAGGCCAACTCTTCATTTCTGG - Intergenic
1014903834 6:127002569-127002591 GGATGCCAAGTCCTAATTCCTGG - Intergenic
1020131065 7:5558896-5558918 GGAGGGAAGGGCCTCATTTCTGG + Intronic
1023396639 7:39757801-39757823 GGCAGCCAAATCCTCTTTTCAGG - Intergenic
1023508231 7:40922323-40922345 GCACTCCAAGTCCTAATTTCAGG + Intergenic
1025073142 7:55918758-55918780 GGAGGCCAAGGCCTCACTCGAGG + Intronic
1026145745 7:67744992-67745014 GGATGCCAGGTTCTCATTTCTGG + Intergenic
1026253253 7:68689281-68689303 GTGGGCCAAGTCTTCATTTGCGG - Intergenic
1027215356 7:76179970-76179992 GGAGGAAAAGAACTCATTTCTGG - Intergenic
1027261518 7:76468093-76468115 GGAGGCCAGGGCCTGATTCCCGG + Intronic
1027312899 7:76966202-76966224 GGAGGCCAGGGCCTGATTCCCGG + Intergenic
1028885499 7:95928251-95928273 GGAGGCCAAGTCCTCATTTCTGG + Intronic
1029994510 7:104993937-104993959 GGACGAGAAGGCCTCATTTCTGG - Intergenic
1031716538 7:125115578-125115600 GAAGGCAAAGTCCCCACTTCTGG + Intergenic
1034199897 7:149277792-149277814 AGAGGACAAGTGCTCATTTCGGG + Intronic
1035515146 8:226457-226479 AGAAGGAAAGTCCTCATTTCAGG - Intergenic
1035747520 8:1973259-1973281 GGAGGCAGAGGCCACATTTCTGG + Intergenic
1039375701 8:37030944-37030966 GGAGGCTGAGGCCTCACTTCAGG - Intergenic
1041007519 8:53509626-53509648 TGATGCCATGTCCCCATTTCAGG + Intergenic
1041575610 8:59391253-59391275 GTAGGCACAGTCATCATTTCAGG - Intergenic
1041771106 8:61473289-61473311 GTAGGACATGTCTTCATTTCAGG - Intronic
1042984860 8:74572115-74572137 AGAGGACAAGTCCTCTTTTCAGG - Intergenic
1044815731 8:96110374-96110396 GGAGCCCAAAGCATCATTTCTGG - Intergenic
1045931163 8:107628347-107628369 GAAGGCCATATCCTCATTCCTGG + Intergenic
1047227636 8:122970265-122970287 GGTGACAAAGTCCACATTTCAGG - Intronic
1057092920 9:92276408-92276430 GGAGGGCACGTCCTAATTGCTGG + Intronic
1057759248 9:97859520-97859542 GGAAGCCACGTCCTGATTTCGGG + Intergenic
1060152008 9:121294712-121294734 GGAGACCCAGGCCTCAGTTCTGG + Intronic
1062049325 9:134438897-134438919 GGAGGCCAGGTTCTGCTTTCAGG - Intronic
1062581641 9:137231558-137231580 GGCGGCCAAGGGCTCAATTCAGG + Intronic
1186036521 X:5429134-5429156 GGATGCGAAGTTCTCATTTAGGG + Intergenic
1188477660 X:30604284-30604306 CTAGGTCAAGTCCTGATTTCAGG + Intergenic
1189996841 X:46647075-46647097 AGATGCCAAGTCCTCACTACGGG + Intronic
1197099774 X:122638273-122638295 GGAAACCAGTTCCTCATTTCTGG - Intergenic
1197784799 X:130188853-130188875 GGAGGCCAAGGCCTCACTTGAGG - Intergenic
1199151365 X:144490586-144490608 GCAGGCCCAGGCCTCGTTTCGGG - Intergenic
1201390694 Y:13493972-13493994 GCAGGCCCAGGCCTGATTTCAGG + Intergenic
1202590942 Y:26482516-26482538 GCAGGCCAAATCCTCAACTCTGG - Intergenic