ID: 1028887752

View in Genome Browser
Species Human (GRCh38)
Location 7:95953170-95953192
Sequence AAATATGTTCTAAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028887752_1028887754 30 Left 1028887752 7:95953170-95953192 CCTTCACACTTTAGAACATATTT 0: 1
1: 0
2: 1
3: 25
4: 327
Right 1028887754 7:95953223-95953245 TAAGCAACTGTAGCATCTTTTGG No data
1028887752_1028887753 -8 Left 1028887752 7:95953170-95953192 CCTTCACACTTTAGAACATATTT 0: 1
1: 0
2: 1
3: 25
4: 327
Right 1028887753 7:95953185-95953207 ACATATTTTCATAATCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028887752 Original CRISPR AAATATGTTCTAAAGTGTGA AGG (reversed) Intronic
901782008 1:11600267-11600289 AAATATGTTCTATTGAGTGTGGG - Intergenic
904991186 1:34594012-34594034 AAATATGTTCTAGTGTCTCATGG - Intergenic
906964882 1:50446626-50446648 AAATATGTTACAAACTATGAAGG - Intronic
908259668 1:62329889-62329911 AAATATATTCCAAAGTGTCAGGG + Intergenic
908953986 1:69598722-69598744 AAACATGTTGGAATGTGTGATGG - Intronic
909849393 1:80441322-80441344 AAATATATTCTAAACCCTGAGGG + Intergenic
909911230 1:81260437-81260459 AAATAGGTTGTAAGGGGTGAAGG - Intergenic
910626747 1:89315654-89315676 AAATATGTTCCAAAATTTTATGG - Intergenic
912276898 1:108268492-108268514 AAATATTTTCTAAATTTTCAAGG + Intergenic
912291331 1:108425864-108425886 AAATATTTTCTAAATTTTCAAGG - Intronic
914216720 1:145637695-145637717 AAATATATTCAAAAAAGTGAAGG + Intronic
914469287 1:147960378-147960400 AAATATATTCAAAAAAGTGAAGG + Intronic
918332945 1:183476768-183476790 AAATATGATCTTAAATATGAGGG + Intronic
918816263 1:189189373-189189395 AAATATGTTTTAAATTGTAAAGG - Intergenic
918818361 1:189221405-189221427 ACATATGCACTAAAGAGTGAGGG + Intergenic
919019266 1:192083233-192083255 AAATAAGCTCTAAAGAGTGTGGG - Intergenic
919134446 1:193490125-193490147 CAGTTGGTTCTAAAGTGTGAAGG + Intergenic
919297281 1:195719053-195719075 AAATGTGTTCCCAAGTGCGAGGG + Intergenic
922096288 1:222445769-222445791 AAATATGATCTCCAGTGTGTTGG - Intergenic
922484734 1:225964840-225964862 AAATATGTTCATGTGTGTGATGG + Intergenic
922544514 1:226445925-226445947 AACTATGTTCTCAGATGTGAGGG + Intergenic
923820775 1:237438201-237438223 AAATATGTTCAAAAATATAAAGG - Intronic
923971650 1:239209447-239209469 AATGTTGTTCAAAAGTGTGAAGG - Intergenic
924910719 1:248510058-248510080 AAATATGGTGTAAACTGTAATGG - Intergenic
924913382 1:248537982-248538004 AAATATGGTGTAAACTGTAATGG + Intergenic
1062794142 10:330306-330328 AAATCTGTTCTCTAGTATGAAGG - Intronic
1063356309 10:5402204-5402226 AAAGATGATTTAAAGTGGGATGG - Intronic
1063387777 10:5626946-5626968 AAATATGTTTCACAGTGAGAAGG + Intergenic
1063989465 10:11544382-11544404 AAATATTTTCCACAGTGAGAAGG - Intronic
1064670212 10:17706289-17706311 AATTTTTTTCAAAAGTGTGATGG - Intronic
1064968781 10:21041837-21041859 ATATATGGTCTAAAGTGGGGAGG - Intronic
1065466023 10:26023517-26023539 AAACATGTTACAAAGTGTCAAGG - Intronic
1066000872 10:31103157-31103179 AAATATGATCCAAGATGTGAAGG + Intergenic
1066590364 10:36987906-36987928 AAACATGATCTATACTGTGAAGG + Intergenic
1066702283 10:38142835-38142857 AATTATGTTGTAAAGTGAGAAGG - Intergenic
1066990197 10:42505868-42505890 AATTATGTTGTAAATTGAGAAGG + Intergenic
1068129671 10:52881877-52881899 AAATTTCTTCTAACGTGTCATGG + Intergenic
1068350983 10:55844821-55844843 AAATATGTCTTAAAGTGTGCAGG + Intergenic
1069432139 10:68347182-68347204 AAATATGTTATAAAAGTTGAGGG - Intronic
1071141201 10:82511199-82511221 AAATCTGTTCTACATTGTGTTGG + Intronic
1071765836 10:88663917-88663939 AAATATGTTCTTAAAGGTCAAGG + Intergenic
1071783787 10:88877216-88877238 AAATATGTTAGCAACTGTGATGG + Intergenic
1071823646 10:89302814-89302836 AAATATTTTCTCCAGTTTGAAGG + Intronic
1072290202 10:93958200-93958222 TAATATGTTATAAAGTATGGTGG - Intergenic
1073646299 10:105307897-105307919 AAAAATGTGATAAAGTGTTAAGG + Intergenic
1074503612 10:114046563-114046585 AAATATTTTTTAAAGGGAGAGGG + Exonic
1075110434 10:119576282-119576304 AGATATATTCAAAAGTTTGATGG - Intronic
1075178954 10:120192607-120192629 AAATAAGTCCTAATGTTTGATGG - Intergenic
1076849913 10:133087770-133087792 AAATACGCTCTGCAGTGTGACGG + Intronic
1077978275 11:7272786-7272808 AAATAAGCTCTGAAGTGTCATGG + Intronic
1080624918 11:34020249-34020271 AATAATGTTTTACAGTGTGAAGG + Intergenic
1081050255 11:38331327-38331349 AAATATGGTGTAAAATGTGGTGG - Intergenic
1081182112 11:39996605-39996627 ATATATGTTCTAAAATTTCAAGG + Intergenic
1082715637 11:56608931-56608953 AAATATGTTTTAATTTCTGATGG - Intergenic
1082857099 11:57817772-57817794 TAATATATGCTAAAGTGAGAGGG - Exonic
1083446906 11:62714210-62714232 AACTATTTTCTACAGTGTGGAGG - Exonic
1084501075 11:69535880-69535902 AAGAATGTTCCAGAGTGTGAAGG + Intergenic
1086572225 11:88298386-88298408 AAATCTGTTTTCAAGTGTAAAGG + Intronic
1087404030 11:97706715-97706737 AAATATTTTCTAATGTTAGAGGG + Intergenic
1088694709 11:112356772-112356794 AAAGATGATTTAAAGTGTAAGGG + Intergenic
1089089891 11:115863082-115863104 GAATAAGTTCTAATGTTTGATGG - Intergenic
1089226404 11:116926604-116926626 AAATATGTAATAAAGTGGAAAGG - Intronic
1090335625 11:125961478-125961500 ATAGATTTTCCAAAGTGTGATGG + Intronic
1091069946 11:132553656-132553678 AAATATATTCTAAAATGTAGAGG + Intronic
1091353201 11:134914106-134914128 ATAAATGTTCTAACGTTTGACGG + Intergenic
1093316861 12:17663108-17663130 AAAAATGTTTTAAAGTGAGTAGG + Intergenic
1093934533 12:24986723-24986745 TAATATGTTCTAAAGTGAATGGG + Intergenic
1094028568 12:25985190-25985212 ACAAATGTTCTGTAGTGTGATGG + Intronic
1094050965 12:26220276-26220298 TGATATGTTCTAAGGTGAGAGGG - Intronic
1096937881 12:55303890-55303912 AAATAAGTGCTAAATTTTGATGG - Intergenic
1099072026 12:78056803-78056825 AAATATGTTTTAAAGATTAAAGG + Intronic
1099333459 12:81322215-81322237 AAATACGTTCTTAAATATGAGGG + Intronic
1099427006 12:82535660-82535682 AAATATGTAGTAAAATGTAAGGG - Intergenic
1099465636 12:82984196-82984218 AGATATGTTTTAAACTTTGAGGG + Intronic
1099466580 12:82995370-82995392 ACATCTGTTCTAAGATGTGAAGG + Intronic
1100733799 12:97503700-97503722 AAATGTCAGCTAAAGTGTGAAGG + Intergenic
1100927322 12:99563821-99563843 AAAAATGTTTTAAAGTGGGTGGG - Intronic
1100994052 12:100282766-100282788 AAATTTGTACTAAAGTGTATTGG + Intronic
1101944274 12:109124039-109124061 AAATGTGTGCTAAAGTATTACGG - Intronic
1102725680 12:115062451-115062473 TACTATGTTCTAAAATGTCATGG - Intergenic
1103609244 12:122111747-122111769 AAATATGATCAGAAATGTGAAGG + Intronic
1105066580 12:133205748-133205770 CAAGATGTTCTAACCTGTGAAGG - Intergenic
1105360915 13:19715336-19715358 AAATATTTTCCAAAGTGGCATGG + Intronic
1106637892 13:31550567-31550589 AAAGAAGTTCTATAGAGTGAAGG - Intergenic
1107582911 13:41811070-41811092 AAATAAGTTCTAATCAGTGAAGG + Intronic
1107700843 13:43046221-43046243 AAATATATTCAAAAGTCTCACGG - Intronic
1109587096 13:64420215-64420237 AAATTTTATCTAAAGTTTGAAGG + Intergenic
1110682374 13:78330633-78330655 ATAAATATTCAAAAGTGTGAGGG - Intergenic
1110848427 13:80216871-80216893 AAAAATGTTAAAAAGTCTGAAGG - Intergenic
1113169506 13:107484462-107484484 ATATATGCTCTGAAGTGAGAGGG + Intronic
1113393808 13:109924086-109924108 CAATTTCTTCTACAGTGTGAAGG + Intergenic
1114598694 14:23936064-23936086 AAATATGTTCAAAAATCTGATGG - Intergenic
1116730438 14:48614423-48614445 ATATATTTTCTATAGTGTTATGG + Intergenic
1116764479 14:49053512-49053534 GAATGTGTTCCAAAGTGTTAGGG - Intergenic
1119393712 14:74310069-74310091 AAATATATTCTACACAGTGAGGG - Intronic
1119960029 14:78844756-78844778 AAAAATATTCTGGAGTGTGATGG + Intronic
1120626713 14:86836448-86836470 ACATAAGTTCTAATGTTTGATGG + Intergenic
1124172156 15:27385435-27385457 AAATATGTTCTAAAAAATCATGG - Intronic
1126789758 15:52210297-52210319 ATATGTGTTCTAAAGAGTAATGG - Intronic
1127047093 15:55037425-55037447 AAACATGTTCTAATGTCTTAAGG - Intergenic
1127680442 15:61290929-61290951 GAACATGTTCTAATGTGTGATGG + Intergenic
1128528414 15:68428208-68428230 AAATATGTTCTAAGCTGAGCTGG - Intronic
1129567372 15:76637102-76637124 AAAAATGTTCTAAAGTTAGGTGG - Intronic
1130558135 15:84937562-84937584 AATTATGTTTTAAATTGTAAAGG + Intronic
1130787040 15:87110465-87110487 AAATGAGTTCTAATGTTTGATGG + Intergenic
1133527204 16:6617255-6617277 AAATATTGTCTAGAGTGTGAAGG + Intronic
1135499582 16:22982367-22982389 AAATATGTTATATATTGTTAAGG + Intergenic
1138234116 16:55365909-55365931 AAATATATTCTCAAATCTGATGG + Intergenic
1138427086 16:56942408-56942430 AAATATGTGATAGAATGTGATGG - Intronic
1138841132 16:60508097-60508119 AAAAATCTTCAAAAGTGTGGAGG - Intergenic
1139811828 16:69625629-69625651 AAATATTTTCTCAAGGGTGTTGG + Intronic
1140175250 16:72652355-72652377 AAATATGTTCAACAATGTAAAGG - Intergenic
1141061975 16:80882003-80882025 AAAAATGTTTTAAAGGGTGATGG + Intergenic
1141752093 16:85965363-85965385 TAATCTGCTCTACAGTGTGAAGG - Intergenic
1143206580 17:5144702-5144724 AAATATGCTCCCAAGTTTGATGG + Exonic
1145358417 17:22185759-22185781 AAAAATCTTCAAAAGTGAGAAGG - Intergenic
1146625054 17:34428758-34428780 AAAAATGTTCTAAAGGGGGATGG - Intergenic
1149338236 17:55659648-55659670 AAATTTGTTTTAAAGGGAGAGGG + Intergenic
1149939083 17:60843896-60843918 GAATATGTTCAACAGTGGGAAGG + Intronic
1151013516 17:70529239-70529261 AGATTTGTTCTAAATTGCGAGGG + Intergenic
1151083893 17:71359355-71359377 AAATAGGTTCTAAATTTTGGTGG - Intergenic
1151157945 17:72140057-72140079 AAGTGTGTTCTACAGTGTGGGGG - Intergenic
1152808250 17:82368525-82368547 AAAAATTTTTTAAAGGGTGAAGG - Intergenic
1153084846 18:1272642-1272664 ATATACTTTCTAAAGTGTGATGG - Intergenic
1156685314 18:39637969-39637991 AAATCTGTTCTAGATTTTGAAGG - Intergenic
1158372771 18:56828579-56828601 AAATATTTTTTAAAATCTGAAGG + Intronic
1159198293 18:65147665-65147687 AAATATTTTATAAAGTGTTGTGG + Intergenic
1159460661 18:68718897-68718919 AAATATGCTTTAAAGAATGATGG + Intronic
1159544441 18:69821469-69821491 AAATATCCTATAAACTGTGATGG - Intronic
1160067313 18:75587834-75587856 AATTATTTTTTAAAGTGTCAAGG + Intergenic
1160137921 18:76288962-76288984 AAATATGTTCAAAAACTTGAAGG + Intergenic
1164383806 19:27756691-27756713 TAATATATGCTAAAGTGAGAGGG - Intergenic
1164817787 19:31218855-31218877 CATTATTTTCTAAAGTGTCATGG + Intergenic
1166510360 19:43404047-43404069 AAAGATGGTCAAAAGTGTGTGGG + Intronic
925602465 2:5623025-5623047 AAATATGTTCTAAAGCCAAAAGG + Intergenic
926930083 2:18028819-18028841 GAATAAGTTCTAATGTTTGATGG - Intronic
928207173 2:29293912-29293934 AAAAATTTTGTAATGTGTGAAGG + Intronic
929304986 2:40351122-40351144 AAATATGATACAAAGTATGATGG - Intronic
929675106 2:43918632-43918654 AAGTGTGTAATAAAGTGTGATGG - Intronic
930526178 2:52533059-52533081 GAACAAGTTCTAAAGTATGAGGG - Intergenic
930729660 2:54715841-54715863 AAAAATGTTCTAAAATTAGATGG - Intergenic
931346041 2:61447512-61447534 ACATCTGTTTGAAAGTGTGATGG - Intronic
931581907 2:63785060-63785082 AAATATTTTTTAATGTTTGAAGG - Intronic
932547687 2:72732084-72732106 AAAAATATTGTAAACTGTGATGG + Intronic
932796261 2:74698752-74698774 GAATACGTTCTCAAGTGGGAAGG - Intergenic
933638455 2:84732680-84732702 TTAAATGTTCTAAATTGTGATGG + Intronic
933640354 2:84752548-84752570 TAAAATGCTCTAAATTGTGATGG - Intronic
936809267 2:116376869-116376891 AAATATGTGCCAAAGTGTTACGG + Intergenic
938683322 2:133713785-133713807 AATTATGTTTCATAGTGTGATGG + Intergenic
939061974 2:137433231-137433253 AAATGTGATCTAAAAAGTGAAGG + Intronic
939071572 2:137550586-137550608 AAATATGTTGTGTAGTGGGAAGG + Intronic
939672321 2:145027992-145028014 AGATTTATTCTAAAGTATGATGG + Intergenic
939754939 2:146098850-146098872 AAAAATGTTCTAAGGTATTATGG - Intergenic
940039001 2:149339803-149339825 AAATAGGTTCAAAAGTGTTTAGG + Intronic
940395733 2:153189045-153189067 TAATAAGTTCTAATGTTTGATGG - Intergenic
941946165 2:171100277-171100299 AAATTTGGTCCAAAGTGTGGCGG + Intronic
943234615 2:185301171-185301193 AGATCTGTTCAAAAGTTTGATGG + Intergenic
943912640 2:193588375-193588397 AAATATGTTCTCACATGTGTAGG - Intergenic
944125155 2:196284079-196284101 AAGTATGATATAAGGTGTGAGGG - Intronic
944143932 2:196485825-196485847 AAATGTGATCAAAAGTGTGAGGG + Intronic
947423181 2:229959045-229959067 CACTGTGTTCTACAGTGTGAAGG - Intronic
947902274 2:233731223-233731245 AAAAATGTTGAAAAGTGGGATGG + Intronic
1170098890 20:12676761-12676783 AAATATGTACTAAAGGGTCAGGG + Intergenic
1170161497 20:13317434-13317456 AAATTGGTTCTAAAGTGTATAGG + Intergenic
1171043954 20:21792922-21792944 AAATAATTTCAAAAGAGTGAAGG + Intergenic
1173048823 20:39539341-39539363 AAATATTTTCAAAAGTGAAATGG - Intergenic
1173375291 20:42477443-42477465 AACTAGGTTTTAGAGTGTGATGG + Intronic
1173529730 20:43760123-43760145 AAATATGTTCTCACTTCTGAGGG + Intergenic
1175414379 20:58792264-58792286 CAATTTCTACTAAAGTGTGAAGG - Intergenic
1175424902 20:58857151-58857173 AAATATGTTAGAATGTGTGATGG + Intronic
1177733131 21:25054473-25054495 AAGCATCTTCTAAAGTGTTATGG + Intergenic
1177879617 21:26676222-26676244 ATCAATGTTCTAAAGTATGAAGG - Intergenic
1177888169 21:26771351-26771373 AAAGATGATTTAAAGTATGAGGG + Intergenic
1178318562 21:31587471-31587493 AGACATGTTCAAATGTGTGAAGG + Intergenic
1179253498 21:39695093-39695115 AAATATGTCCAAAAGTGGGCAGG - Intergenic
1182263246 22:29091432-29091454 AAATTTTTTTTAAAGTGTGAAGG - Intronic
949174530 3:1043375-1043397 AAATATGTTAATAATTGTGATGG - Intergenic
950237115 3:11332805-11332827 GAATATGTTCAAAAGAGTTAAGG + Intronic
950740643 3:15048928-15048950 CAATATTTTCTATATTGTGAAGG - Exonic
951702640 3:25511579-25511601 GAATATGTGCAAAATTGTGAAGG + Intronic
952012851 3:28920766-28920788 AAATATGTTCTAAAGTGTTTAGG + Intergenic
952079015 3:29734311-29734333 AAATAAGTTCTAGAGTTTTATGG + Intronic
952460593 3:33521548-33521570 AAATAACTTCAAAAGTGTCATGG + Intronic
953225908 3:41020382-41020404 AAAAATGTTCTAAAATTGGAAGG + Intergenic
953366901 3:42352823-42352845 ATGAATGTTCTAAAGTGTGAGGG + Intergenic
955375201 3:58389342-58389364 AAACATGTTCTAAAGTCAGCTGG - Intronic
958639601 3:96788478-96788500 AAATAAGTTCTAAAAATTGATGG - Intergenic
959315271 3:104797445-104797467 AAATATGTTTTAAAGAGTGGTGG + Intergenic
959826298 3:110800718-110800740 AAATACATTTTAAAGTGTCATGG + Intergenic
961958943 3:130833676-130833698 AGATCTGTTCTACAGTCTGAGGG - Intergenic
962627848 3:137244749-137244771 TAATATGTTCCAAAGTGTAGGGG + Intergenic
963089467 3:141469395-141469417 GAATATGTTCTAGTGTTTGATGG - Intergenic
963180196 3:142347050-142347072 AAAAATGTTCTAAATTTAGATGG + Intronic
965877428 3:173343620-173343642 ACATATGTTCTACAGCCTGAGGG + Intergenic
966745403 3:183270416-183270438 CAATTTGTTCTAAACTTTGAAGG - Exonic
967273519 3:187750807-187750829 AAATATGTTTTGAAATGTAAAGG - Intergenic
971511101 4:27425043-27425065 AAAGATGCTCTTCAGTGTGATGG + Intergenic
972145486 4:36019757-36019779 AAATAGGTTATAAAGAGGGAGGG + Intronic
972242439 4:37207823-37207845 AAATATGTGTTAAACTATGAGGG + Intergenic
974641467 4:64637026-64637048 CAATATGTTATAAAAAGTGAAGG + Intergenic
974753803 4:66177127-66177149 AAAAATGCTATAAAGTGTGGTGG + Intergenic
975425336 4:74219071-74219093 AAAGATGATTTAAAGTGTGTAGG + Intronic
975905254 4:79203265-79203287 GAATATATTCTAAACTCTGAAGG + Intergenic
976202008 4:82588223-82588245 AAATATGTTCTAATTTGTTCAGG - Intergenic
977142715 4:93394693-93394715 GAATATGTTCCCAAATGTGAAGG + Intronic
977298157 4:95234157-95234179 AAATATATTGTAAAATGTGGGGG + Intronic
977837322 4:101660486-101660508 AAATATGTTCTAAATGGTTTTGG - Intronic
980500365 4:133643571-133643593 AAAAATGTTATAAATTGTGATGG + Intergenic
981444297 4:144817873-144817895 GAATAAGTTCTAATGTTTGAAGG + Intergenic
981977754 4:150751278-150751300 AAACATTTTGTAAATTGTGAAGG - Intronic
982104953 4:152003827-152003849 CAATATGTTATAAAATGTTAAGG - Intergenic
982197365 4:152929823-152929845 AAATATGTTCGAATCTGTCATGG + Intergenic
982342160 4:154311643-154311665 AAATAAATTCTAAACAGTGAGGG + Intronic
982744253 4:159090133-159090155 AAATAAGTTCTAGTGTTTGATGG - Intergenic
982759012 4:159258380-159258402 AAATATTTTCTATATTGAGATGG + Intronic
983603063 4:169551429-169551451 AAAAATGTTCAAAAAGGTGAAGG + Intronic
983980970 4:173996711-173996733 AAATATGCTCTGAAGTATTAGGG + Intergenic
984410190 4:179388010-179388032 AAATATGTTAGAAATTGTCATGG + Intergenic
985299050 4:188468281-188468303 AAATATGTACAAAAGTGAAAGGG - Intergenic
986137422 5:4993964-4993986 ACATATGTTCAATAGTGTGTGGG - Intergenic
986889337 5:12282256-12282278 AAATATTTTTTAAAAGGTGAAGG - Intergenic
987573786 5:19701407-19701429 AAATATGGCCCAAAGAGTGAGGG + Intronic
987844706 5:23267943-23267965 AAATATTTTCTAAAGTTTTGAGG - Intergenic
988007132 5:25430133-25430155 AAATATGACTTAAAATGTGAGGG - Intergenic
988327726 5:29791812-29791834 AAATATGATCAACAGTGTAAAGG + Intergenic
989089808 5:37718401-37718423 AAATATGTTTTCAAGTGAGCAGG - Intronic
989373764 5:40737681-40737703 AAAAATGTTCTTTATTGTGATGG - Intronic
989516043 5:42344856-42344878 GAATCTGTTCTAATGTTTGATGG + Intergenic
990374898 5:55159571-55159593 AAATATGTTAAAAACAGTGAAGG - Intronic
991473128 5:66990795-66990817 AAATATGTTCTAGAGTTTCCTGG + Intronic
993586719 5:89740016-89740038 AAATATGTTCAGAGGTCTGATGG + Intergenic
994011912 5:94914663-94914685 AAATGTGTTCTGAAGTGTAATGG + Intronic
994672737 5:102782134-102782156 TAATGTGTTCTAAAGTGTTCAGG - Intronic
996664343 5:126040930-126040952 AAATATGTTCCACATTTTGAAGG + Intergenic
996754952 5:126925986-126926008 AAATGTGTTCTAAGGACTGAAGG + Intronic
997861829 5:137424867-137424889 AAAAATGTTCTAAATCTTGATGG + Intronic
998312989 5:141153704-141153726 AGATATGGGCTAAACTGTGAAGG - Intergenic
998323891 5:141261020-141261042 ACATGTTTTCTAAAGTGTGAGGG - Intergenic
998654860 5:144166779-144166801 ATATATGTACTAAAGGGTCAGGG + Intronic
999524451 5:152388488-152388510 AAATATGTGATAAAGTGAGTTGG - Intergenic
999592341 5:153161948-153161970 AAAAATGCTCTAAAGGCTGATGG + Intergenic
999629604 5:153556679-153556701 AAATAAGTTTTAAAGTGGAAGGG - Intronic
1000093590 5:157951255-157951277 AAAATTGTCCTAAAATGTGAGGG - Intergenic
1000315536 5:160086862-160086884 AAATATGACAAAAAGTGTGATGG - Intronic
1000950845 5:167480745-167480767 AAAGATGCTCTAAAGGGTTAGGG - Intronic
1003069445 6:2933472-2933494 AAATAAGTTCTAACTTTTGAAGG - Intergenic
1003476014 6:6483661-6483683 ATATATGTTCAGAAGTGGGATGG - Intergenic
1003559626 6:7170050-7170072 CAATATTTTGTAAAGTGTGGGGG - Intronic
1004104000 6:12646264-12646286 CAATGTGTTTAAAAGTGTGATGG - Intergenic
1004206960 6:13600497-13600519 AAATATGTTTTAAAAAGTTATGG + Intronic
1004798939 6:19123651-19123673 AAATCTGTGGTAGAGTGTGAAGG + Intergenic
1006710594 6:36065827-36065849 AAATATTTCCTAATGTGTTAAGG - Intronic
1008113010 6:47513864-47513886 AAATTTTTTTTAAAGTCTGATGG - Intronic
1008296889 6:49789129-49789151 AAATATGATCCAGAGTGTTAGGG + Intergenic
1009232417 6:61079486-61079508 AAATATGTATTAAAGAGTGTAGG - Intergenic
1009294678 6:61931486-61931508 TAATATGTTATCAAGTGTTAAGG - Intronic
1009644741 6:66383604-66383626 ACATATATTCTAATTTGTGAGGG + Intergenic
1009670200 6:66739193-66739215 ATGTATATTCTAAAGTGTTATGG + Intergenic
1009814691 6:68717102-68717124 AAATATGTTATAAAATGTAGTGG - Intronic
1010949414 6:82017427-82017449 ACAAATGTTCTAAAGAGGGAAGG - Intergenic
1010949769 6:82021846-82021868 AACTATATTCTAAAATGGGATGG - Intergenic
1011571157 6:88737353-88737375 AAATATCATCTAAAGTGGAAAGG - Intronic
1011774418 6:90712769-90712791 CAAAATGTTCAACAGTGTGATGG - Intergenic
1012239427 6:96855337-96855359 AAATATTGTCAAAAGTGCGAGGG - Intergenic
1014619686 6:123651147-123651169 AATTATGTTCTATATTTTGAAGG - Intergenic
1014808084 6:125854039-125854061 ACATATGCTCAAAAGGGTGAAGG + Intronic
1015029024 6:128571663-128571685 AAATATGTTCCATACTGTAATGG - Intergenic
1015070833 6:129090770-129090792 AGATATTTTCTGCAGTGTGATGG - Intronic
1015367189 6:132409369-132409391 AGATATTTTCTCAATTGTGAAGG + Intergenic
1016218108 6:141628136-141628158 AAATATGTTCAAATATTTGATGG + Intergenic
1019507444 7:1399422-1399444 AACTGTGTTCTCATGTGTGAGGG + Intergenic
1020615996 7:10463228-10463250 ACATTTTTTCTAAAATGTGATGG - Intergenic
1020898563 7:13973784-13973806 AAATATTTTCAGAATTGTGAAGG - Intronic
1022680557 7:32541598-32541620 GACAATTTTCTAAAGTGTGAGGG - Intronic
1023348526 7:39295939-39295961 TAATTTCTGCTAAAGTGTGAAGG - Intronic
1023513139 7:40974357-40974379 AAATAAGGTCAAAAGTGTGGGGG + Intergenic
1024581966 7:50807731-50807753 ACATGTGTTGTAAAGTGTTAAGG - Intergenic
1025190823 7:56894377-56894399 ATATAGGTTTTAAAGTTTGAGGG + Intergenic
1025681120 7:63682547-63682569 ATATAGGTTTTAAAGTTTGAGGG - Intergenic
1026073109 7:67140280-67140302 AAATATTTTATAAAGTCTAAAGG - Intronic
1026703776 7:72671934-72671956 AAATATTTTATAAAGTCTAAAGG + Intronic
1028887752 7:95953170-95953192 AAATATGTTCTAAAGTGTGAAGG - Intronic
1030551201 7:110962210-110962232 AATTATTTTGTAAAATGTGAAGG - Intronic
1031470171 7:122159197-122159219 AAATATTATCTAAAGAGTTATGG + Intergenic
1031644877 7:124212200-124212222 AAATATAGTCTAAAGAGTAAAGG + Intergenic
1031733337 7:125325542-125325564 AAATATGTGTTAAAGTATTAAGG + Intergenic
1033865903 7:145690057-145690079 ATATATGTTCTAAAATTTTATGG + Intergenic
1033890761 7:146010445-146010467 AAGTATGTTCTTAAATGTTACGG + Intergenic
1034094135 7:148390721-148390743 AAATAGGTTCTAAGGTATGCTGG + Intronic
1034094447 7:148394098-148394120 AAATAAGTTCTAAATGGAGAAGG - Intronic
1034733284 7:153406389-153406411 AAATATGCTGTTTAGTGTGAGGG - Intergenic
1035456905 7:159014645-159014667 AATTATGTTCTAGAGTGTGGGGG - Intergenic
1036978046 8:13437048-13437070 AAATAGTTTCTAAAATCTGATGG + Intronic
1037145106 8:15562402-15562424 AAATAGGATGTAAAGTGTAAGGG + Intronic
1037530845 8:19771987-19772009 AAACATGATCCCAAGTGTGATGG + Intergenic
1038602820 8:28964591-28964613 AAGTATTTTCTAAAATTTGATGG + Intronic
1039539714 8:38354548-38354570 AAATATGTGATAAAGTGTCATGG + Intronic
1040559273 8:48509706-48509728 AAATCTGTTAAAAAGTGTGCTGG + Intergenic
1040908086 8:52489354-52489376 AAATATGTTCAAAAGGCTAAAGG + Intergenic
1041339327 8:56825609-56825631 AAAAAAGCTCTAAAGTTTGATGG + Intergenic
1041621353 8:59973600-59973622 AAATATGTTCAGAAGTATGTAGG - Intergenic
1041629754 8:60073703-60073725 AAAAATGTAATAAGGTGTGATGG + Intergenic
1042119505 8:65470058-65470080 AAATGTTTTCTAAAATGTGTAGG - Intergenic
1042539545 8:69894341-69894363 AAATATGTACTTACGTGTGCAGG - Intergenic
1043152396 8:76734141-76734163 AAATATGTTCTAAACATTAAAGG - Intronic
1043718950 8:83519787-83519809 ATATATGTTCAATAGTGTCAAGG + Intergenic
1043909801 8:85850361-85850383 ATAGATGTTTTAAAGTGTCAGGG - Intergenic
1044030600 8:87230511-87230533 AAATGTGTTCTAACATCTGAAGG - Intronic
1044064213 8:87679899-87679921 CAATAAGTTTAAAAGTGTGAAGG - Intergenic
1044358484 8:91254385-91254407 AAATATGTTAGAAAGTGTCTTGG - Intronic
1044446127 8:92278485-92278507 AAATATTTTCTAAAGCCTGCTGG + Intergenic
1044512872 8:93103901-93103923 ATAAAAGTTCTAAAGAGTGATGG - Intergenic
1046174100 8:110552331-110552353 AAATATCCTTTAAACTGTGAAGG - Intergenic
1046546585 8:115658971-115658993 AAATATGTTATAAATAATGAGGG + Intronic
1047026406 8:120829309-120829331 AAATATTTTATAAACTGTAAAGG - Intergenic
1047284135 8:123471916-123471938 AAAGATATTTTAAAGTGTGATGG - Intergenic
1048088900 8:131217506-131217528 AAATTAGTTTTCAAGTGTGAGGG - Intergenic
1048415650 8:134225215-134225237 AAATATGTTCTATATCTTGAGGG - Intergenic
1049112800 8:140659134-140659156 AGATACGTTCTAAAGGGGGATGG - Exonic
1050649482 9:7759961-7759983 AAATATGATCTGAAATCTGAAGG - Intergenic
1050802549 9:9633662-9633684 AAATATTTTCTAAAGGTTGTAGG + Intronic
1051651429 9:19330273-19330295 AAATATGTACTGAAGTGTCATGG + Intronic
1052619412 9:30886737-30886759 AAATATTTACAAAAGTGTGTTGG - Intergenic
1052820401 9:33133930-33133952 AACTAGGTTCTAAAGTCTGCAGG - Intronic
1054960419 9:70962141-70962163 ATATAAGTTCTAAAGTTTAAAGG - Intronic
1055256243 9:74374915-74374937 GCATATGGTCTAAATTGTGAGGG - Intergenic
1056471985 9:86914318-86914340 GAAAATGTTCTAAAATGAGATGG + Intergenic
1058560447 9:106223354-106223376 AAGTATGTTCTAACATGTGCTGG - Intergenic
1059719065 9:116941694-116941716 ATAAATGTACTAGAGTGTGATGG - Intronic
1059782614 9:117545538-117545560 AAATATATTCTAAAGTATTTAGG - Intergenic
1186358553 X:8813532-8813554 AAATAACATCTAAATTGTGAGGG + Intergenic
1186636599 X:11412334-11412356 ATATGTGTTCTAAAGTGTTTTGG - Intronic
1187087247 X:16053438-16053460 AAATGTTTTCTGAAGTGTCAAGG - Intergenic
1188146363 X:26618570-26618592 AATTTTGTTCTAATATGTGATGG + Intergenic
1188902340 X:35749486-35749508 AAATATGGTTTAAAGTCTGTAGG + Intergenic
1191956833 X:66651487-66651509 AAATATGTTCACAAGAGTAAAGG + Intergenic
1192119704 X:68443717-68443739 AAATTTTTTTTAAAGAGTGAGGG - Intergenic
1192365561 X:70469763-70469785 AAATATGAACCATAGTGTGAAGG + Intronic
1192457481 X:71289078-71289100 AAATATGCTTAAATGTGTGATGG + Intronic
1192614467 X:72604708-72604730 CAAAATGGTATAAAGTGTGAAGG - Intronic
1193431443 X:81411215-81411237 TAATTTGATCAAAAGTGTGATGG + Intergenic
1194480950 X:94423715-94423737 AAATATTTTCTAGATTGTGTGGG + Intergenic
1194602976 X:95946413-95946435 AAATATGTGGTAAGGTATGAGGG - Intergenic
1195051951 X:101105212-101105234 ATATATGTTTTAAGGTGAGATGG - Intronic
1195279160 X:103312837-103312859 AAATATGTTTTAAATTCTGTTGG - Intergenic
1195471978 X:105240771-105240793 ATATATGTTCCAAAATGTTATGG - Intronic
1196333190 X:114496644-114496666 AAATATTTTTTAAAGTTTGTGGG + Intergenic
1196348667 X:114700292-114700314 TATCATGTTCTAAAGTTTGATGG + Intronic
1197101770 X:122664668-122664690 AAAAATGTTGTAAAGTGTCTTGG + Intergenic
1198206454 X:134470013-134470035 AAATATGTTCTGATATGTGAAGG + Intronic
1199581428 X:149364230-149364252 AAATATATTCTAAAGCTTCAGGG - Intergenic
1199660228 X:150042017-150042039 AAATATGTTTTTAAGAATGAAGG - Intergenic
1201613988 Y:15875215-15875237 AAATATGTTCTACATTTTGTAGG - Intergenic
1201616380 Y:15904565-15904587 AAATATGTTCTACATTTTGTAGG + Intergenic