ID: 1028887754

View in Genome Browser
Species Human (GRCh38)
Location 7:95953223-95953245
Sequence TAAGCAACTGTAGCATCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028887752_1028887754 30 Left 1028887752 7:95953170-95953192 CCTTCACACTTTAGAACATATTT 0: 1
1: 0
2: 1
3: 25
4: 327
Right 1028887754 7:95953223-95953245 TAAGCAACTGTAGCATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028887754 Original CRISPR TAAGCAACTGTAGCATCTTT TGG Intronic
No off target data available for this crispr