ID: 1028889432

View in Genome Browser
Species Human (GRCh38)
Location 7:95970467-95970489
Sequence ATCTGCACAAAGGGTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028889426_1028889432 -4 Left 1028889426 7:95970448-95970470 CCCAGAGAGATATATCCGAATCT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG No data
1028889427_1028889432 -5 Left 1028889427 7:95970449-95970471 CCAGAGAGATATATCCGAATCTG 0: 1
1: 0
2: 1
3: 4
4: 60
Right 1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG No data
1028889424_1028889432 1 Left 1028889424 7:95970443-95970465 CCATCCCCAGAGAGATATATCCG 0: 1
1: 0
2: 1
3: 2
4: 76
Right 1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG No data
1028889425_1028889432 -3 Left 1028889425 7:95970447-95970469 CCCCAGAGAGATATATCCGAATC 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028889432 Original CRISPR ATCTGCACAAAGGGTGTGCT GGG Intronic
No off target data available for this crispr