ID: 1028891544

View in Genome Browser
Species Human (GRCh38)
Location 7:95993384-95993406
Sequence ACCCAGCTGGGTCTCATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028891544_1028891549 26 Left 1028891544 7:95993384-95993406 CCAACAATGAGACCCAGCTGGGT 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1028891549 7:95993433-95993455 CTCCTTAGCCCCTGTGGTGGTGG No data
1028891544_1028891547 20 Left 1028891544 7:95993384-95993406 CCAACAATGAGACCCAGCTGGGT 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1028891547 7:95993427-95993449 TAGCTGCTCCTTAGCCCCTGTGG No data
1028891544_1028891548 23 Left 1028891544 7:95993384-95993406 CCAACAATGAGACCCAGCTGGGT 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1028891548 7:95993430-95993452 CTGCTCCTTAGCCCCTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028891544 Original CRISPR ACCCAGCTGGGTCTCATTGT TGG (reversed) Intronic
900606877 1:3527664-3527686 CCCCAGCTGACTCTCATTGGAGG - Intronic
900774137 1:4569252-4569274 AGCCAACTGGCTTTCATTGTAGG - Intergenic
902219020 1:14953010-14953032 AGCCAGCTGGGGCTCAGTCTTGG - Intronic
902414461 1:16230726-16230748 GCCCAGCAGGGGCTCATTGGAGG + Intergenic
903276739 1:22226726-22226748 ACCCAGCTAGGTTTTGTTGTTGG - Intergenic
906935043 1:50207399-50207421 ACCCATCTGTGTGTCATAGTGGG - Intergenic
913046837 1:115080814-115080836 ATCCAGCTGGCTCTCATCCTAGG + Intronic
918230162 1:182522093-182522115 TCTCACCTGGGTCTCATTGATGG - Exonic
1064041317 10:11967696-11967718 ACCCAGCTGGGTGTGGTGGTGGG - Intronic
1066229771 10:33421077-33421099 AACCATTTGGGTCTCATGGTGGG + Intergenic
1070909400 10:80104363-80104385 AGCTAGCTGGGTGTCATTGGTGG - Intergenic
1073094644 10:100972187-100972209 ACCGAGTTGCATCTCATTGTTGG + Intronic
1075172314 10:120127457-120127479 ACCCAGCTGGGTGGCACTGGGGG + Intergenic
1075594726 10:123720694-123720716 ACAAAGTTGGGTCTCACTGTGGG + Intronic
1077183703 11:1227393-1227415 ACCCAGGTGGCACTCACTGTGGG - Exonic
1078614530 11:12852845-12852867 ACTCAGCAGAGTCTGATTGTGGG + Intronic
1085184608 11:74564902-74564924 GCCCAGCTTGGTCTCAGTGCTGG - Intronic
1086377989 11:86220888-86220910 ACCCAGTTGGGCATCAGTGTAGG + Intergenic
1087562121 11:99803249-99803271 ACTCATCTGGGTATCATTGCTGG - Intronic
1089603326 11:119627946-119627968 ACCCAGCGGGCTCTCCTGGTGGG + Intronic
1090912760 11:131135753-131135775 ACCCAGCTGGGTTTCCTGGCTGG - Intergenic
1091823706 12:3493854-3493876 ACCCAGCTGGGGCTCCTTGGAGG + Intronic
1092372803 12:7931261-7931283 AACCAGCTGGGCATCGTTGTTGG - Exonic
1093353136 12:18128373-18128395 CCCCAGCAGGGACTCTTTGTGGG - Intronic
1095111207 12:38296434-38296456 TCCCAGCAGGGACTCTTTGTGGG + Intergenic
1097703443 12:62843998-62844020 ACCCATCTGAGTTTCATTTTAGG + Intronic
1098607041 12:72403741-72403763 TCCTAGCTGGGTTTCAATGTTGG - Intronic
1105923751 13:24987797-24987819 TCCCAGCTGGGTGTCAGGGTGGG + Intergenic
1109512995 13:63404127-63404149 CCCCAGCAGGGACTCAGTGTGGG + Intergenic
1110075206 13:71231797-71231819 AACCAGCGTGGTCTCATGGTTGG + Intergenic
1112116810 13:96365073-96365095 ACCCCACTGGGTCACATTGGAGG - Intronic
1115342972 14:32311828-32311850 ACCCAGCTGAGGCCCACTGTTGG + Intergenic
1119199048 14:72739653-72739675 TTCCAGCTGCGTCTCATTCTTGG - Intronic
1120398658 14:84000760-84000782 ACCCAAATGGTTCTTATTGTCGG - Intergenic
1122900843 14:104781733-104781755 ACCCAGCAGGGCCTGAGTGTGGG + Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124147406 15:27140324-27140346 ACCCAGCTGGTGTCCATTGTGGG + Intronic
1127267162 15:57371702-57371724 ACACAGCTGGGTCTCACTGGAGG + Intergenic
1131221002 15:90584045-90584067 ACCCAGCTGGAGATCATTCTAGG - Intronic
1132091021 15:98948045-98948067 ACCCAGGTGGTTCTCACTGCCGG - Intronic
1132238264 15:100238044-100238066 ACCCAGCTTGCTCCCACTGTGGG + Intronic
1134140445 16:11713764-11713786 ACCCAGAAGGGTCTCAATGCAGG + Intronic
1140690721 16:77480846-77480868 CCCCAGCTTGCTCTCATGGTTGG + Intergenic
1141688890 16:85585543-85585565 GCCCAGCTGGGTCTCCATGTGGG + Intergenic
1143244749 17:5474651-5474673 TCCCAGCTGGGTCTCATTATTGG + Exonic
1143287692 17:5802432-5802454 ACCCAACTGGGATTCATTGAAGG - Intronic
1144803653 17:17949388-17949410 ACCCAGTTGGGCCTCCTTGGGGG - Intronic
1147553687 17:41462949-41462971 AGCCAGCTGGGCCTCAACGTTGG + Exonic
1147582689 17:41636115-41636137 ACCCAGGTGGGCCTCACTCTGGG + Intergenic
1148446862 17:47743176-47743198 TCCTACCTGGGTCACATTGTTGG - Exonic
1149667804 17:58378026-58378048 ACCAAGCTGGGCCTCAGTGGTGG - Intronic
1149682644 17:58516968-58516990 GCCCAACTGGGGCTCATTTTAGG + Intronic
1151433684 17:74081387-74081409 GCCCAGATGGTTGTCATTGTGGG - Intergenic
1156065677 18:33140250-33140272 CCCCAGTAGGGACTCATTGTGGG - Intronic
1157417203 18:47513733-47513755 ACCCAGCTGGAACTCACTTTGGG - Intergenic
1160041983 18:75353639-75353661 CCCCAGCGGGGACTCTTTGTGGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162106099 19:8370836-8370858 ACCCAGCAGGGACTGAGTGTGGG - Intronic
1163931409 19:20396741-20396763 AATTAGCTGGGTGTCATTGTGGG + Intergenic
1164144338 19:22501927-22501949 ACTCAGCTGGGTCTCGTTTCTGG + Intronic
1165013472 19:32864760-32864782 ACCCAGCTGGGCCTCATCAGTGG - Exonic
1165490427 19:36120240-36120262 GCCCAGCTGGGCCTCATGCTGGG - Intronic
925310489 2:2878261-2878283 CCCCATCTGGGTGCCATTGTGGG - Intergenic
927910139 2:26891606-26891628 AGCCAGCTGGGTCTGAATGAAGG + Intronic
930717164 2:54604070-54604092 ACCCAGCTGGGTGGCCTTGCTGG - Intronic
931399185 2:61914933-61914955 ACCCACCTGGGCCTCATGTTTGG + Intronic
936663594 2:114569571-114569593 AACCTGATGGGCCTCATTGTTGG - Intronic
936734733 2:115427260-115427282 TCCCAGCTGGGACTCTGTGTGGG + Intronic
938946490 2:136216975-136216997 ATTGAGCTGGGTCTCACTGTGGG - Intergenic
939010638 2:136841756-136841778 ACCCAGCTGTGTATTCTTGTAGG - Intronic
941647098 2:168052145-168052167 ACACAGCTGGGTCTCAATGGAGG + Intronic
942981855 2:182092990-182093012 CCCCAGCAGGGACTCTTTGTGGG + Intronic
944078746 2:195760498-195760520 ACCCAGCACAGTCTCAATGTTGG + Intronic
1172652199 20:36511724-36511746 AATCAGCTGGGTGTCATCGTGGG + Intronic
1172654762 20:36529932-36529954 CCCCAGCTGGGTCTCAGGGTAGG - Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1179470211 21:41605373-41605395 ACCCAGCTCCGTCTCTTTCTGGG - Intergenic
1182016356 22:27043365-27043387 ACCAAGCTGGCTTTCACTGTGGG - Intergenic
1184577238 22:45380290-45380312 ACCCAGATGTGTGTTATTGTGGG + Intronic
1184767991 22:46581977-46581999 ACCCACCTGGGCCTCCCTGTGGG - Intronic
1185297721 22:50062417-50062439 ACCCAGGCGGGTCTCATTTCAGG + Intronic
953498704 3:43412220-43412242 ACCAAGCTAGGCATCATTGTAGG - Intronic
953788205 3:45927038-45927060 ACCCAGGTAGGTCACATTCTAGG + Intronic
959546126 3:107598927-107598949 GCCTAGCTGGGTCCTATTGTGGG - Intronic
961090645 3:124108219-124108241 ACCCAGTTGGGTCTTATCCTTGG - Intronic
964938676 3:162127002-162127024 CCCAACCTGGGTCTCAATGTTGG + Intergenic
965646408 3:170886304-170886326 CCCCAGCTTGGTTTCTTTGTGGG + Intergenic
967453700 3:189655836-189655858 ACCCATCAGGTTCTCACTGTAGG + Intronic
968833654 4:2947147-2947169 ACCCAACTGGGTTTCACTGAAGG + Intronic
969158847 4:5237495-5237517 GCCCAGCTGGATTTTATTGTTGG + Intronic
972520943 4:39856014-39856036 ACCCTGATGTGTCTCAGTGTGGG - Intronic
977309091 4:95362530-95362552 AGCCAGATGGGTCTAATTCTGGG + Intronic
977666957 4:99653521-99653543 ACTCAGCTGGATCTCATGGGTGG + Exonic
977898003 4:102385552-102385574 ACCCAGATGGGTCTGATTCCTGG - Intronic
982745608 4:159102677-159102699 ACGCGGCTGGGTCTCCTAGTAGG + Intergenic
984951923 4:185014452-185014474 TGCCAGCTTGGGCTCATTGTGGG + Intergenic
985808900 5:2068808-2068830 GCACAGCTGGGTGTCGTTGTGGG - Intergenic
987967321 5:24893383-24893405 CCCCAGCTGGGACTCTTTTTGGG + Intergenic
993874053 5:93285640-93285662 ACTCAGCTTTTTCTCATTGTTGG - Intergenic
994974201 5:106780692-106780714 ACCCAGCAGAGTCCCAGTGTTGG + Intergenic
997180515 5:131824085-131824107 ACCCAGCTTAGTCCCATTGGTGG - Intronic
1001437480 5:171711551-171711573 TCTCAGCTGTGTTTCATTGTGGG - Intergenic
1001595919 5:172898671-172898693 ACCCCTCTGGGTCTCAGTATTGG + Intronic
1001706447 5:173744418-173744440 TCCCAGCTGGGTGGCATTGGGGG + Intergenic
1001731402 5:173963149-173963171 GTCAAGCTGGGTGTCATTGTTGG + Intergenic
1003444083 6:6169084-6169106 ACCAAGCTGGCTCTCATTCCAGG + Intronic
1004400336 6:15282888-15282910 ACCCCGCCCGGTCTGATTGTTGG + Intronic
1005804584 6:29462341-29462363 AGCCAACTGGATTTCATTGTAGG - Exonic
1005818181 6:29574473-29574495 AGCCATCTGGATCTCATTGTAGG - Intronic
1005819817 6:29588516-29588538 AGCCACCTGGATCTCATTGTAGG - Exonic
1009346127 6:62614482-62614504 CCCCAGCAGGGACTCTTTGTGGG - Intergenic
1011707433 6:90015682-90015704 ACCAAGGTGGGTCACATTCTGGG - Intronic
1013127445 6:107198228-107198250 ACCCAGTAGGGACACATTGTTGG + Intronic
1013221374 6:108080580-108080602 ACCCAGCTGGCTTTCACAGTGGG - Intronic
1013479018 6:110536574-110536596 AAACAGCTGTGTCTCATTCTAGG + Intergenic
1015212356 6:130712648-130712670 CCCCAGCTGTGTCTCCTTGCAGG + Intergenic
1016221664 6:141679093-141679115 AATCAGCTGGGTCTTACTGTTGG - Intergenic
1017455295 6:154596113-154596135 AACCAGCTGAGCCTCTTTGTTGG - Intergenic
1018603692 6:165575467-165575489 ACTCAGCTGGCTCTCTTTTTTGG + Intronic
1022385130 7:29892306-29892328 AGGCAGCTGGATCTCATAGTGGG + Intronic
1024244165 7:47456811-47456833 ACCCAGCTGGTTCTCACTGTTGG - Intronic
1025957568 7:66194506-66194528 AGCCAGCTGGGTTTTTTTGTTGG - Intergenic
1028891544 7:95993384-95993406 ACCCAGCTGGGTCTCATTGTTGG - Intronic
1033055392 7:138047911-138047933 GCTCAGCTGGGTCTCATTATTGG - Intronic
1034223268 7:149461181-149461203 CCCCAGCAGGGTCTGATTCTAGG - Intergenic
1037521738 8:19686495-19686517 ACCCAGCTGGCTGTCCTTGGGGG + Intronic
1041016870 8:53599954-53599976 GCCCAGCTGGGTTTCATAATGGG - Intergenic
1041143936 8:54851637-54851659 ACTCAGCTGGGTTTCACTCTGGG + Intergenic
1043888946 8:85634823-85634845 ACTCAGCTTGGTCTCATTCACGG - Intergenic
1043987338 8:86709081-86709103 ACCTAGCTTGTTCTCTTTGTTGG - Intronic
1044358041 8:91248235-91248257 ACCCCGCTGCGTCTCTTCGTTGG + Intronic
1044476612 8:92633693-92633715 ACCCATCAGGGTCTCATAGCTGG - Intergenic
1047200299 8:122759800-122759822 TCCCAGCTGGGGCTGAGTGTAGG - Intergenic
1049039100 8:140099012-140099034 ACCCAGCTACGTCTCAGTGCGGG + Intronic
1049784790 8:144445075-144445097 ACGCAGCTGGGTCACATTTGGGG + Intergenic
1051140677 9:13975879-13975901 ACCCAGCTGAGTGTCATTTGTGG - Intergenic
1053154564 9:35767946-35767968 ACTTAGCTGGGTGTCATGGTGGG - Intergenic
1054884269 9:70178799-70178821 ACACAGCTAGCTCTCCTTGTGGG + Intronic
1056040600 9:82661696-82661718 ACTGAGCTGTGTCCCATTGTAGG + Intergenic
1057161922 9:92895126-92895148 GCCCAGCTGGGCCTCATCCTGGG - Intergenic
1059042701 9:110831092-110831114 AACCAGCTGGGTCTCATTTCAGG - Intergenic
1060222999 9:121774238-121774260 TCACAGCTGTGTTTCATTGTAGG + Exonic
1061826003 9:133258540-133258562 AGCCTGCTGGGCCTCCTTGTGGG + Intronic
1061844374 9:133378764-133378786 GCCCAGCTGGTCCTCATTGCAGG + Intronic
1185773292 X:2782359-2782381 ACCCAACTGGTTCACTTTGTTGG + Intronic
1190415980 X:50180804-50180826 ACCCTGCAGGCTCTCATTGATGG - Intergenic
1191022617 X:55878646-55878668 AGGCAGCTGTGCCTCATTGTGGG - Intergenic
1199702758 X:150396593-150396615 ACCAAGATGGATCTCATTCTGGG - Intronic