ID: 1028895095

View in Genome Browser
Species Human (GRCh38)
Location 7:96032015-96032037
Sequence TACCGTTTGCAGTAGTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028895095 Original CRISPR TACCGTTTGCAGTAGTATAG AGG (reversed) Intronic
911602312 1:99859408-99859430 TCCCGTTTGTAGTAGTATTATGG + Intronic
921116626 1:212098384-212098406 TATCAACTGCAGTAGTATAGCGG + Intronic
924402435 1:243700239-243700261 TACCATTTACAGTAGTAATGTGG - Intronic
1068173130 10:53422037-53422059 CATCAGTTGCAGTAGTATAGGGG + Intergenic
1071125242 10:82327301-82327323 TACCATGTCCAGTAGTACAGTGG - Intronic
1074379269 10:112965486-112965508 AACCGTTTGCTGTAGTGTTGAGG + Intronic
1080020510 11:27554819-27554841 TTCCTTTTCCAGTAGTAAAGAGG - Intergenic
1086282353 11:85205458-85205480 TACAGTGTTCAATAGTATAGTGG + Intronic
1092064131 12:5575599-5575621 TACTGTAGGCAGTAATATAGTGG + Intronic
1099883343 12:88496562-88496584 AACCATTTGCATTTGTATAGTGG + Exonic
1103112170 12:118290090-118290112 TAACACTGGCAGTAGTATAGAGG - Intronic
1161521268 19:4724690-4724712 TACCGGTTTCCGTAGTGTAGCGG - Intergenic
936457738 2:112688336-112688358 TACCTTTTGCATTTTTATAGAGG + Intergenic
941152466 2:161931803-161931825 TACCGTTGGCAGTAATATAAAGG + Intronic
945739217 2:213640904-213640926 CACCAGCTGCAGTAGTATAGAGG + Intronic
946488899 2:220128860-220128882 TATCCTTTGCAGTCCTATAGAGG + Intergenic
966570721 3:181440224-181440246 TATCATTTGCAGTAGAAAAGTGG + Intergenic
973220416 4:47719975-47719997 AATCGGTTGTAGTAGTATAGGGG + Intronic
974178506 4:58356911-58356933 TAATGTTTGCAGCAGTAAAGTGG + Intergenic
975473019 4:74792740-74792762 TAGAGTTTGCAATAGTAGAGAGG - Intronic
980539086 4:134170207-134170229 TGTCCTTTGCAGCAGTATAGAGG - Intergenic
998237638 5:140412976-140412998 TACTGTTTTCAGTAGTAGAAAGG + Intronic
1014174769 6:118320103-118320125 CACTGTCTGCAGTAGAATAGCGG + Intergenic
1028895095 7:96032015-96032037 TACCGTTTGCAGTAGTATAGAGG - Intronic
1034139726 7:148804318-148804340 TACCCTTTGTTGAAGTATAGGGG + Intergenic
1041082909 8:54230359-54230381 CACCATTTTCAGCAGTATAGTGG - Intergenic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1051925684 9:22322165-22322187 CACTGTTTTCAGTGGTATAGAGG + Intergenic
1060122549 9:121007983-121008005 CACTGTTTTCAGTGGTATAGAGG + Intronic
1198008024 X:132518874-132518896 TGTCGTTTGCACTAGTATGGTGG - Intergenic