ID: 1028896576

View in Genome Browser
Species Human (GRCh38)
Location 7:96048302-96048324
Sequence CAGCTTTGAATGTCAGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028896576_1028896584 29 Left 1028896576 7:96048302-96048324 CCTGAATCTGACATTCAAAGCTG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1028896584 7:96048354-96048376 CAGGTGAACAGATCCAGGTTTGG No data
1028896576_1028896583 24 Left 1028896576 7:96048302-96048324 CCTGAATCTGACATTCAAAGCTG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1028896583 7:96048349-96048371 TAGAGCAGGTGAACAGATCCAGG No data
1028896576_1028896585 30 Left 1028896576 7:96048302-96048324 CCTGAATCTGACATTCAAAGCTG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1028896585 7:96048355-96048377 AGGTGAACAGATCCAGGTTTGGG 0: 1
1: 0
2: 1
3: 13
4: 187
1028896576_1028896578 10 Left 1028896576 7:96048302-96048324 CCTGAATCTGACATTCAAAGCTG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028896576 Original CRISPR CAGCTTTGAATGTCAGATTC AGG (reversed) Intronic
900562017 1:3311915-3311937 CAGCTTTGCAGGTCAGCTCCCGG + Intronic
901015454 1:6226909-6226931 AAGCAGTGAATGTCAGAATCAGG + Intronic
903754298 1:25650071-25650093 CTGCTTTGAGTGTCAGAAACTGG - Intronic
903798195 1:25946174-25946196 CTGCTTTTAATGTCAGAGCCAGG - Intergenic
903874172 1:26461162-26461184 CAGCTTTGATTTTAAAATTCAGG - Intronic
904918480 1:33987126-33987148 CAGCCTTGAATGGTAGACTCTGG + Intronic
910494155 1:87807452-87807474 GAGTTTTGAATGTCAGTTTAAGG + Intergenic
912748692 1:112267719-112267741 CAGCCATGAATGTCAGTTTGAGG + Intergenic
912926760 1:113919880-113919902 CAACTTTTAATTTTAGATTCAGG - Intergenic
918193438 1:182198756-182198778 CACCTTTGAATGCCAGATTAAGG - Intergenic
918898641 1:190382634-190382656 CAGCTTTGAATGGCATATTCTGG - Intronic
924284567 1:242472811-242472833 CATCTATGAATTTCAGATTATGG + Intronic
1062951573 10:1507585-1507607 CAGCTTTGAATGGCAGGGACTGG + Intronic
1064422186 10:15199796-15199818 CATCTTTGAAAGACAAATTCTGG - Intergenic
1070538726 10:77400603-77400625 CAGCTTTGAGTGACAGAGCCAGG - Intronic
1070584023 10:77747613-77747635 CTCCTTTGAAAGTCAGATTTGGG + Intergenic
1071458503 10:85869533-85869555 CAGCTTTCCTTGTCAGAATCAGG - Intronic
1071494117 10:86155991-86156013 CAGCTAGGAAGGTCAGATTGCGG - Intronic
1074795950 10:116943975-116943997 CAGCTTTGAATCTCTTGTTCCGG - Intronic
1075113791 10:119609113-119609135 CAGATTTGAGTCTCAGATGCTGG - Intergenic
1075177319 10:120177610-120177632 CAGCTGTCAATGTGATATTCTGG + Intergenic
1078025852 11:7694916-7694938 CAGCTTTGTGTGTCAGGTGCTGG + Intronic
1081330240 11:41792432-41792454 CTGCTTTGACTCTCAGAATCTGG + Intergenic
1083912748 11:65719757-65719779 CAGCTTTGAATTTCAAGCTCTGG + Exonic
1085734494 11:79027522-79027544 CAGCTGAGAATGCCAGTTTCTGG - Intronic
1085978587 11:81693694-81693716 CAGCTTTCTATGTTAGTTTCAGG - Intergenic
1086094137 11:83033689-83033711 CAGTTTTGAATGTTAATTTCTGG - Intronic
1086123571 11:83326673-83326695 CAGCTCTCTATGTCAGTTTCAGG + Intergenic
1086263694 11:84972696-84972718 CAGCTTTTAATTTAATATTCGGG - Intronic
1086355984 11:86000034-86000056 TAGTTTTAAAAGTCAGATTCTGG - Intronic
1087573272 11:99958452-99958474 CAGTTTTGAATATGAGATACAGG + Intronic
1088841605 11:113632075-113632097 CAACTTTGAATGTCAGACTAAGG + Intergenic
1090378282 11:126306898-126306920 CATTTTTGATTGTCAGAATCGGG + Intronic
1090557202 11:127889158-127889180 CAGCATTGTATTTCAGGTTCTGG - Intergenic
1091609800 12:1996295-1996317 TAGCTTGGAATGGCAGACTCTGG - Intronic
1094067166 12:26373479-26373501 CATTTTTGAATTTCAGGTTCTGG + Intronic
1098926664 12:76358720-76358742 GAGTCTTGAATGTCAGGTTCTGG + Exonic
1102113822 12:110385461-110385483 CAGCTTGGAATCTCAGACCCAGG - Intronic
1102949979 12:117025014-117025036 CTGCTTTGAAGGTCAGAAGCAGG - Intronic
1105609000 13:21951186-21951208 CAACTTTGAGTGGCAGATTTGGG + Intergenic
1106925424 13:34607994-34608016 CAGACTTGAATGTCAGGTTAGGG - Intergenic
1106925542 13:34608903-34608925 CAGGTTTGAATGTCACATAAGGG - Intergenic
1108786053 13:53902571-53902593 CAGTTTTGAAAGTCAGAAACAGG + Intergenic
1109904380 13:68819386-68819408 CAGCATGGAATGACAGATCCTGG + Intergenic
1110321907 13:74170264-74170286 CTGCTTTCAATGTCAGTGTCCGG + Intergenic
1111840564 13:93444736-93444758 AAGCTTTGAATATCACATTGTGG + Intronic
1113188094 13:107713016-107713038 CAGCTCTGAATGTCCTGTTCTGG - Intronic
1115680023 14:35727976-35727998 CAGCTCTGAATGCCAGATTAAGG + Intronic
1116430006 14:44835830-44835852 CAGCGTGGAATGTCAGACTGAGG - Intergenic
1116787528 14:49303997-49304019 CAGCTTTGAATCTCTGAGACAGG - Intergenic
1117939354 14:60945059-60945081 TAGCTTTGAAACTCTGATTCAGG - Intronic
1119591359 14:75891074-75891096 AAGGCTTGAATGTCAGAGTCAGG - Intronic
1121251524 14:92503283-92503305 CTGCCTTGAATGTCAGATCATGG + Intergenic
1121791921 14:96705164-96705186 GAGATTTGAATGTCACTTTCTGG - Intergenic
1122642085 14:103165857-103165879 CTGCTTTGACCCTCAGATTCTGG + Intergenic
1123137865 14:106046372-106046394 CATTTTTCAATGTCAGATTATGG + Intergenic
1123812587 15:23943519-23943541 CCGCTTTGATTGTAAGTTTCTGG + Intergenic
1124404126 15:29379188-29379210 AAGCAATGAATGTCAGTTTCAGG + Intronic
1124828400 15:33123354-33123376 AGGCTTTGAATGCCAGATTCAGG - Intronic
1134027631 16:10966444-10966466 GAGCTGGGAATGTCAGATTTGGG + Intronic
1135808732 16:25568392-25568414 CAGCTATGAATGGCATCTTCAGG + Intergenic
1137614061 16:49836579-49836601 CAGCTTTGAAGGTCAGCCTGAGG - Intronic
1138182133 16:54948574-54948596 GGGCTTTGAATGACAGATACAGG - Intergenic
1145006802 17:19342971-19342993 CAGCTTTGAGTGGCAGAACCTGG + Intronic
1148584738 17:48769347-48769369 GAGCTTTGAATGGCAGTTACAGG - Intronic
1148858096 17:50590223-50590245 CAGCTCTGGGTCTCAGATTCAGG - Intronic
1151175361 17:72283900-72283922 CAGCTCTGCATGTCAGGTTTGGG - Intergenic
1155591269 18:27429531-27429553 CAGCTATGAATCTCAGTTCCTGG - Intergenic
1155839880 18:30631440-30631462 CTGCTTTGACCCTCAGATTCTGG - Intergenic
1155918528 18:31579454-31579476 CATCTCTGAATGTCAGACTAAGG + Intergenic
1163510470 19:17732359-17732381 CAGCTGTGATTGTAAGATGCAGG + Intronic
925054370 2:845760-845782 CAGATGGGATTGTCAGATTCAGG - Intergenic
925655655 2:6145322-6145344 CAACTTTGAATGGCAGAGCCTGG + Intergenic
925883786 2:8376663-8376685 CAACTTTAAATGTTAGAATCAGG - Intergenic
926652644 2:15363122-15363144 CACCTGTGAATGACAGCTTCAGG + Intronic
930168206 2:48224144-48224166 GAGCTTTGAATGTTGGATTATGG + Intergenic
931465778 2:62485597-62485619 CAGCTTTTAATATAAGATACAGG + Intergenic
935539154 2:104328927-104328949 CATCTTTGAATGTTAGAAACGGG - Intergenic
936840574 2:116763658-116763680 CAGCTTGGAAAGGCAGATTATGG + Intergenic
937555488 2:123150029-123150051 AAGTTTTGAATATCAGACTCAGG - Intergenic
938617973 2:133019436-133019458 CTGCTTTGAATGTCAGGGCCTGG + Intronic
939467268 2:142574240-142574262 TAGCATTGAATATCATATTCAGG + Intergenic
941770507 2:169340279-169340301 CAGCTTTGAATACCACATTTTGG - Intronic
944973923 2:205025741-205025763 CAGCCTTGGATGTCAGAACCGGG - Intronic
945600577 2:211858399-211858421 AAGCTTTAAATTTCAGATTTAGG - Intronic
946393085 2:219428453-219428475 CAGTTTGGAAGGTCAGATTAAGG - Intergenic
946767866 2:223056844-223056866 CACCTTTGTACGTCAGAGTCAGG + Intronic
947442876 2:230138618-230138640 AACCTATGAATATCAGATTCTGG - Intergenic
947447097 2:230172455-230172477 CAGGCTTGAGTGTCAGAATCTGG + Intronic
1169482671 20:5998997-5999019 CTGATTTAAATGTCAGAATCTGG - Intergenic
1170395654 20:15922556-15922578 CAGCTTTAAAGGACAGAGTCTGG + Intronic
1171233694 20:23507985-23508007 CAGCTCTGAAAGTCAGAGTCAGG - Intergenic
1172377309 20:34454598-34454620 TAGCTTTAAATGTCAGAAGCAGG + Intronic
1173419227 20:42886016-42886038 CAGCTTTGAATTTTAAACTCTGG + Intronic
1173541556 20:43855960-43855982 CAGCTTTGAATATCAGAGCCAGG - Intergenic
1173639177 20:44587491-44587513 CAACTTTGGACTTCAGATTCAGG - Intronic
1175713877 20:61242571-61242593 CAGCTTTGACTGTGAGCTTGGGG - Intergenic
1179570704 21:42277155-42277177 TGGCTTTGATTCTCAGATTCAGG + Intronic
1182434050 22:30318869-30318891 CAGCCTTGAATGTCAGGCTGAGG - Intronic
1183805070 22:40202105-40202127 GAGCTTTGAATGTCAGAGAAAGG + Intronic
1184996203 22:48209401-48209423 CACCTTTAAATGTCGGATTCAGG - Intergenic
951369508 3:21828283-21828305 AATCTTTGAATGTCAGTTTCAGG + Intronic
951713920 3:25618121-25618143 CACCTTTTAATGGCAGACTCAGG + Intronic
953769100 3:45765278-45765300 GAACTTTGAATGTCAGGTTGGGG + Intronic
954042866 3:47902949-47902971 CAGCTGGGAATGTCAGTTTATGG - Intronic
955560790 3:60187731-60187753 CATCTTTGACTGTCAGAACCTGG - Intronic
956078314 3:65530203-65530225 CTACTTTGAATGTCACTTTCTGG + Intronic
960247521 3:115415750-115415772 CAGCTTTAATTGTCTGAATCTGG + Intergenic
960466582 3:118003258-118003280 CACCTTTGTATGTAAGACTCAGG + Intergenic
962992020 3:140586522-140586544 CAGGTTTGGCTGCCAGATTCAGG + Intergenic
963920131 3:150897433-150897455 TAACTTTGAATATCATATTCAGG + Intronic
964665714 3:159169753-159169775 TAATTTTGAAGGTCAGATTCTGG + Intronic
965857421 3:173105065-173105087 CAGCTTTTAATTTCAGATGGTGG + Intronic
967749525 3:193098151-193098173 GAGCTTTGAATGCCAGAGTAAGG - Intergenic
967903701 3:194484086-194484108 CATCTCTGAACCTCAGATTCTGG - Intronic
973072333 4:45878521-45878543 CAGCTATCAAAGTCATATTCTGG - Intergenic
973241045 4:47956092-47956114 CTGCTTTGCAGCTCAGATTCTGG + Intronic
974575544 4:63715460-63715482 CAGCTTTGAAAGTCAGTAACAGG - Intergenic
975369741 4:73570946-73570968 CATTTTAGAATGGCAGATTCGGG + Intergenic
976331085 4:83831830-83831852 TAGCTTTGTATATCAGATTAGGG - Intergenic
977712382 4:100142337-100142359 CTACTTTGAAGGTCAGAATCAGG + Intergenic
978128486 4:105164324-105164346 TAGCTGTGTATGTCATATTCAGG + Intronic
979836025 4:125368593-125368615 CAGTTTTGAGTTTCAGAATCAGG - Intronic
981260956 4:142718161-142718183 AGTCTTTGAATGTCAGATTGAGG + Intronic
981865818 4:149417652-149417674 CAACTTTGAATGTTAAATTGTGG - Intergenic
982721957 4:158868815-158868837 CGGCTTTCAAAGTCAGACTCTGG - Exonic
984587744 4:181582231-181582253 CAGCTGTGAATGTGAGAGACAGG - Intergenic
986365047 5:7021312-7021334 CTGCTTTGACTCTCAGAATCTGG - Intergenic
987661254 5:20880113-20880135 CAATTTTGAATGTTAGGTTCAGG - Intergenic
988762332 5:34325219-34325241 CAATTTTGAATGTTAGGTTCAGG + Intergenic
989730291 5:44640874-44640896 CAGATTTGAATTTAGGATTCTGG - Intergenic
990458353 5:56010579-56010601 TAGGATTTAATGTCAGATTCAGG - Intergenic
991985616 5:72283515-72283537 CAGGTTGCAATTTCAGATTCCGG + Intronic
992906701 5:81353996-81354018 CGGCTTTAAATGTCAGAGTCTGG + Intronic
993852103 5:93023376-93023398 CATCTTAGAATGTAAGCTTCTGG - Intergenic
993922886 5:93829085-93829107 CGGCCTTGAATGTCATATTAAGG - Intronic
997680816 5:135749470-135749492 CAGCTCTGAGTTTCTGATTCAGG - Intergenic
998585061 5:143418832-143418854 CAACTTGGAGTGTCAGAGTCTGG - Intronic
1000818890 5:165958987-165959009 CAGGTTTAAGTGACAGATTCAGG + Intergenic
1002008327 5:176254382-176254404 CAGTTTTGAATGTCTGGTTATGG + Intronic
1002183842 5:177444830-177444852 CAGCTTTGAAAGCTAGATTAAGG + Intergenic
1002913038 6:1505725-1505747 CAGATCTGATTGTCTGATTCTGG - Intergenic
1008675256 6:53812127-53812149 CAGCCTTGAATGCCAGGTTAAGG + Intronic
1010472025 6:76240091-76240113 AAGATTTGAATTTCAGAGTCTGG + Intergenic
1010533005 6:76990455-76990477 CTGCTTTGACTCTCAGAATCTGG + Intergenic
1012043231 6:94237289-94237311 CAGTTCTGAATTTCAGATTTAGG - Intergenic
1012275992 6:97276267-97276289 AAGCTTTTAATGACAGATTTTGG - Intronic
1013287003 6:108690460-108690482 CAGCTTTCAGTGGCAGAGTCAGG - Intergenic
1013678900 6:112500467-112500489 CAACTTTGGATTTCAGTTTCTGG + Intergenic
1017429487 6:154356795-154356817 CAGCTTTGAATGTTAGTTCTGGG - Intronic
1020395714 7:7715385-7715407 TAGCTTTGAGTTTCAGATTTGGG - Intronic
1020464713 7:8464411-8464433 ATGCTTTGAATGTCTGACTCAGG - Intronic
1022322772 7:29302993-29303015 CAGCTTAGAGTGACAGATCCCGG + Intronic
1022503750 7:30897899-30897921 GGGCTTTGAATGTCAGGTTAAGG + Intergenic
1022615371 7:31924442-31924464 CAGCTTTGAATTCCAACTTCAGG + Intronic
1022923734 7:35039952-35039974 CAACTTGGAATGTCAACTTCAGG - Intergenic
1023756061 7:43417802-43417824 CAGTTTTCTCTGTCAGATTCAGG + Intronic
1024544140 7:50502885-50502907 AAGCTCAGAATGTAAGATTCAGG + Intronic
1028896576 7:96048302-96048324 CAGCTTTGAATGTCAGATTCAGG - Intronic
1031131453 7:117837800-117837822 GAACTTTGAATTTCAGATTAGGG + Intronic
1035548904 8:504769-504791 CTGTTTTGAATGCCAGTTTCTGG - Intronic
1039968184 8:42299024-42299046 CAGGGTTGAATTCCAGATTCTGG - Intronic
1041250570 8:55930499-55930521 CTGCTTTGAATGTCCCCTTCTGG + Intronic
1042505820 8:69558678-69558700 CAGCCTTAAATGTGAGAGTCTGG + Intronic
1043755948 8:84004291-84004313 CAGCTTTGGAAATCACATTCTGG - Intergenic
1044800267 8:95946458-95946480 CAGCTATTATTGTCATATTCAGG - Intergenic
1046259537 8:111748843-111748865 CAGTTTTGATTGTGTGATTCTGG - Intergenic
1050428293 9:5535031-5535053 CACCTTTGACTTTCAGAGTCAGG - Exonic
1051099444 9:13504416-13504438 CAGCTTTGATTTTCTGTTTCTGG + Intergenic
1055901383 9:81242356-81242378 CAGCTGTGAATGTCACACACAGG - Intergenic
1058533107 9:105926320-105926342 GAGCTTTGAATTTCAGACTGTGG + Intergenic
1059248668 9:112868733-112868755 CAGCTTTGAGTTTCCGATTTCGG - Intronic
1186578851 X:10795145-10795167 CATTTTTGAATGTCACATTTTGG - Intronic
1189694857 X:43654115-43654137 CAGCTTTTGATGACAAATTCAGG + Intergenic
1194044952 X:88991258-88991280 CAGGTTTAAATGTCATTTTCAGG - Intergenic
1195132053 X:101862807-101862829 CAGCTTTCAAAGTCACATTTGGG - Intergenic
1198383026 X:136102064-136102086 CAGTTTTGTGTGTCAGATGCAGG - Intergenic
1198535697 X:137583662-137583684 CAGTTTTGAATGCCAGACTGTGG - Intergenic
1198929577 X:141839018-141839040 CAGCTTTCTATGTTAGTTTCGGG + Intronic
1199804354 X:151283000-151283022 CAGCTGTAAATGTCAGAAGCAGG + Intergenic