ID: 1028896578

View in Genome Browser
Species Human (GRCh38)
Location 7:96048335-96048357
Sequence GTCCCCACCATTACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028896576_1028896578 10 Left 1028896576 7:96048302-96048324 CCTGAATCTGACATTCAAAGCTG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028896578 Original CRISPR GTCCCCACCATTACTAGAGC AGG Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
904297296 1:29528297-29528319 GTCCCCCCATTTACTAGAGTTGG + Intergenic
904940183 1:34160239-34160261 GTGCCCACCATATCTAGGGCTGG - Intronic
905865729 1:41375593-41375615 GTCCCCACCATGGCTACAGAGGG - Intronic
907806808 1:57828424-57828446 GTCCCCAAGATTACTGCAGCAGG - Intronic
917764138 1:178199004-178199026 GTGTCCACCATTACTTGAGTAGG - Intronic
921273584 1:213494135-213494157 GTCCCAACCATTTCTGTAGCCGG - Intergenic
924572630 1:245251263-245251285 GTTCCTACCATTCCTAGAACTGG - Intronic
1071114725 10:82204638-82204660 CTCTCCACCATTACTAGCCCTGG + Intronic
1075632364 10:124008464-124008486 GTCCCCACCTTCTCTATAGCCGG - Exonic
1078057369 11:8019148-8019170 GTCCCCGCCATTGGCAGAGCCGG + Intergenic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1086178941 11:83926692-83926714 TTCCACAACATTACTAGAGTTGG + Intronic
1086644507 11:89203326-89203348 GTCCCCAGCTTTACTTTAGCAGG - Intronic
1090229087 11:125088953-125088975 GTCTACTCCATTCCTAGAGCTGG - Exonic
1093658042 12:21720313-21720335 GTTCCCACCATTAGATGAGCAGG - Intronic
1095095091 12:38143030-38143052 GTCCCCACAACTAATAGACCAGG - Intergenic
1096332106 12:50722627-50722649 GTCCCCACCATTACATGCCCAGG + Intronic
1096460192 12:51818151-51818173 CCCCCCAGCATTACCAGAGCTGG + Intergenic
1098949435 12:76624266-76624288 GTTCCCACCATTCCCAGAACTGG - Intergenic
1106644667 13:31619239-31619261 TGCCCCACCATTATTAGAGTTGG - Intergenic
1111726600 13:92017529-92017551 GTCCCCACCTTTCTGAGAGCTGG + Intronic
1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG + Intronic
1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG + Intronic
1122519357 14:102332522-102332544 GTCCCCTCCATCCCTAGAACAGG - Intronic
1122976369 14:105172498-105172520 GTCCCCACCCTGACTGGGGCTGG - Intergenic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128427260 15:67554622-67554644 CTCTGCACCTTTACTAGAGCAGG + Intronic
1129740099 15:77985966-77985988 GTCCCCACCAGGTCTAGATCGGG - Intronic
1134278977 16:12801546-12801568 ATCCCCAGCATTACTAGATGTGG - Intronic
1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG + Intergenic
1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG + Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1145175440 17:20697207-20697229 GTCACCAACACTACTAGAGAAGG - Intergenic
1163817565 19:19476058-19476080 GTCCCCTCCATGACCAGAGGAGG - Intronic
1165792401 19:38500125-38500147 GTCCCCAACATTGCTAGTCCAGG - Intronic
926615284 2:14991186-14991208 GTCCCAGCCCTGACTAGAGCTGG - Intergenic
936786376 2:116098478-116098500 GTCCCCACACTTCCCAGAGCTGG - Intergenic
1170929162 20:20753364-20753386 GTTCCCACTATTACAGGAGCTGG + Intergenic
1173104061 20:40115381-40115403 CACCCCACCATCACTAGGGCTGG + Intergenic
1174373424 20:50109795-50109817 TTCCCCTCCATCACTGGAGCAGG + Intronic
1184630583 22:45775093-45775115 GACTCCACCATTTCTAGAGGTGG + Intronic
951692241 3:25408513-25408535 GTCCCCACCCTAATTAGAGGAGG - Intronic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
953707335 3:45241137-45241159 ATTCCCACCAATACTATAGCAGG - Intergenic
958894474 3:99814495-99814517 CTCCCCACCATTACTAGTCCTGG - Intergenic
961283583 3:125782124-125782146 GTGCTCTCAATTACTAGAGCAGG - Intergenic
969739862 4:9016340-9016362 GTCTTCTCAATTACTAGAGCAGG - Intergenic
970445653 4:16121345-16121367 GTCCCCACCCTGAGTTGAGCAGG - Intergenic
971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG + Intergenic
973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG + Intronic
984552112 4:181173123-181173145 GGCCCCACCATTTCTAAAGGGGG + Intergenic
988275819 5:29080026-29080048 GTCCCCACCCCCACGAGAGCTGG - Intergenic
991019228 5:61962618-61962640 GTAGCCACTATTCCTAGAGCTGG - Intergenic
991420028 5:66431296-66431318 ATCCCCACCAACACTAGAGAAGG + Intergenic
1000337101 5:160249930-160249952 GTCCCCACCCCTCCTAGAGAAGG + Intergenic
1000852056 5:166352503-166352525 GTGCCCACCACTTCTAAAGCTGG + Intergenic
1007239828 6:40416928-40416950 TTCCCCACCCTGACTAGAACAGG - Intronic
1015141597 6:129940489-129940511 GTGCAGACCATTATTAGAGCAGG - Intergenic
1018067499 6:160134111-160134133 GGCCTCACCAGTAGTAGAGCAGG - Exonic
1023742219 7:43290823-43290845 GTCTCCACCATGACAACAGCTGG - Intronic
1027548838 7:79564999-79565021 ATTCCCACCATTACTAGCTCTGG - Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1050274030 9:3977824-3977846 GTCATCACCATTTCTACAGCAGG + Intronic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG + Intergenic
1062676735 9:137750696-137750718 GTCCCCACCACTACTCCAGAGGG - Intronic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1189070899 X:37862793-37862815 GTGCCCACCATTTCTAGTGAAGG + Intronic
1189766617 X:44378635-44378657 GTTCCCACCATTTCTAGAATTGG - Intergenic
1189992804 X:46610572-46610594 GGCCCCACCATGTCTGGAGCTGG + Intronic
1195924801 X:110014815-110014837 GTGCCAACTATTACCAGAGCTGG + Intronic
1201554522 Y:15254694-15254716 GTCTCCTCCCTTACTGGAGCTGG - Intergenic