ID: 1028897700

View in Genome Browser
Species Human (GRCh38)
Location 7:96060843-96060865
Sequence CAATGACGCTTCAGTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028897698_1028897700 -1 Left 1028897698 7:96060821-96060843 CCCTTGCTCTACATGCAAAACTC 0: 1
1: 0
2: 2
3: 13
4: 156
Right 1028897700 7:96060843-96060865 CAATGACGCTTCAGTAATGAAGG No data
1028897699_1028897700 -2 Left 1028897699 7:96060822-96060844 CCTTGCTCTACATGCAAAACTCA 0: 1
1: 0
2: 0
3: 13
4: 193
Right 1028897700 7:96060843-96060865 CAATGACGCTTCAGTAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028897700 Original CRISPR CAATGACGCTTCAGTAATGA AGG Intronic
No off target data available for this crispr