ID: 1028898566

View in Genome Browser
Species Human (GRCh38)
Location 7:96069607-96069629
Sequence CATGAAAATCATGCCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028898560_1028898566 14 Left 1028898560 7:96069570-96069592 CCAGTTTTGAATGAGAACCTTGG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1028898566 7:96069607-96069629 CATGAAAATCATGCCAGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1028898564_1028898566 -3 Left 1028898564 7:96069587-96069609 CCTTGGGTGGAGCTGATATTCAT 0: 1
1: 0
2: 0
3: 24
4: 189
Right 1028898566 7:96069607-96069629 CATGAAAATCATGCCAGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028898566 Original CRISPR CATGAAAATCATGCCAGTGT GGG Intronic
901957719 1:12798352-12798374 CAGGAAAATCATCCCAGTAGTGG - Intergenic
903943234 1:26945927-26945949 CAGGAAAACAATGCCAGTGTTGG + Intronic
904751382 1:32742843-32742865 CTGGAGAAACATGCCAGTGTCGG + Intronic
904855932 1:33498372-33498394 CATGAAAGCAAGGCCAGTGTGGG + Intergenic
911958154 1:104263646-104263668 AATGAAAATAATGCCAGTTGTGG - Intergenic
912620854 1:111155826-111155848 CATGAAAATCTGGCCAGGCTTGG - Intronic
919004821 1:191883466-191883488 CATGAAAGTCAGGATAGTGTTGG - Intergenic
924678769 1:246209183-246209205 AATGAACATCATTCCAGTGAGGG + Intronic
1067859671 10:49832475-49832497 CATAAAAATCACTCCAGTGGAGG + Intronic
1069415395 10:68196098-68196120 CATTAAAAGCATGCCAGGTTGGG - Intronic
1070719092 10:78744194-78744216 TCTGAGAATGATGCCAGTGTGGG + Intergenic
1071302197 10:84264310-84264332 CAGGAAAATTGTGCCAGTGAAGG - Intergenic
1072314739 10:94191031-94191053 CAAGAGAATCAGGCAAGTGTGGG + Intronic
1073713803 10:106078171-106078193 CAAGAAAATCTTCCCAGAGTTGG - Intergenic
1074685338 10:115957126-115957148 CATAAAAAGCATGACAATGTAGG - Intergenic
1075289934 10:121220378-121220400 CATGAAAAACATAACAGTTTTGG - Intergenic
1075449464 10:122539452-122539474 CATAAAAATGATGCCATAGTTGG - Intergenic
1080191968 11:29561517-29561539 CATAAAAATGCTGACAGTGTAGG - Intergenic
1084088888 11:66867450-66867472 CGGGGAAATCCTGCCAGTGTAGG - Intronic
1085234526 11:75003597-75003619 TATGAAAATCAGGCCAGGCTCGG + Intronic
1089866107 11:121633302-121633324 CATGAAACTCATACCATTCTTGG - Exonic
1090588904 11:128244083-128244105 TATGAAAATCATTCCAATGTGGG + Intergenic
1090593028 11:128292478-128292500 ACTGAGAATCATGCCAGTGTAGG + Intergenic
1090950604 11:131469757-131469779 CATCAAAATCATTCCAGTGAGGG - Intronic
1092594996 12:9992818-9992840 CATCAAAATCAGGCCAATATAGG - Intronic
1092644446 12:10554450-10554472 CGTGAAAATAACGACAGTGTTGG + Intergenic
1092807305 12:12236334-12236356 CAAGAAAATCATGACAGTTTTGG + Intronic
1095657802 12:44691057-44691079 CATGAAAGTCATACAACTGTGGG + Intronic
1098248498 12:68544774-68544796 CATGAAAAGCTTGTCACTGTTGG - Intergenic
1100354366 12:93815119-93815141 CATGAAAGTCATGCCAGATATGG - Intronic
1101238015 12:102809486-102809508 GATTAAAAACTTGCCAGTGTTGG - Intergenic
1105654676 13:22423371-22423393 CAGGAGAATCATCACAGTGTGGG - Intergenic
1108099877 13:46943574-46943596 CAGGAATATCTTGCCAGTGGTGG + Intergenic
1108382693 13:49869280-49869302 CACGAAAATTATGCCAGGGCTGG + Intergenic
1109430059 13:62220501-62220523 AATGAAAATCATAGTAGTGTAGG + Intergenic
1109932078 13:69229043-69229065 TATGATAATCATGCCAGTGCAGG + Intergenic
1113419904 13:110163113-110163135 AATGAAAATAATGCCAGCATTGG - Intronic
1118717020 14:68567469-68567491 GATGACAATGATGTCAGTGTAGG - Intronic
1119434077 14:74586573-74586595 CTTGAATTTCAGGCCAGTGTTGG - Intronic
1120316324 14:82898202-82898224 CAGAAAAAACATGCAAGTGTTGG + Intergenic
1124478751 15:30059473-30059495 CATGATGACCATGCCCGTGTGGG + Intergenic
1125302812 15:38275216-38275238 CATAAAAATGATGACAGTGATGG - Intronic
1126014099 15:44333261-44333283 CATAAAAATCATGCCTGGTTAGG - Intronic
1126635036 15:50771737-50771759 TATGAAAATCAGGCCAGTCCCGG + Intergenic
1127490431 15:59457078-59457100 AAATAAAATCAGGCCAGTGTGGG - Intronic
1129617400 15:77109791-77109813 AATGAAAAACATGCCAGGGTTGG + Exonic
1130534477 15:84773838-84773860 CAAGAAAAACATACCAGAGTTGG - Intronic
1130832718 15:87617790-87617812 CATAAAAACCATGTCAGTGAAGG - Intergenic
1131237630 15:90710698-90710720 CAGGAAACTCATGCCAATGTGGG - Intergenic
1131358251 15:91765326-91765348 CAAGAAAATCAATCCAGTTTAGG - Intergenic
1133575110 16:7081333-7081355 CATGTTAATAAGGCCAGTGTGGG - Intronic
1140425177 16:74855089-74855111 CATGAAAATCTTTCCAATTTAGG - Intergenic
1140473654 16:75228100-75228122 CATGAAATTCATGCCTGGGAAGG + Intergenic
1140559961 16:75967560-75967582 CAAATAAATCATGCCAATGTAGG - Intergenic
1142315621 16:89342924-89342946 CATGTAAATGATGCCTGTTTTGG - Intronic
1146994388 17:37305787-37305809 CATGAAAGTTTTACCAGTGTGGG - Intronic
1147300724 17:39524677-39524699 CATGGCAATCCTGCCAGTGGGGG - Exonic
1149736704 17:59001645-59001667 CAGGAAGAGCATACCAGTGTGGG - Exonic
1151054537 17:71016393-71016415 AATGAAAGTCATGGCACTGTTGG - Intergenic
1152132654 17:78486373-78486395 CAAGAAGATCACGCCAGTGCCGG - Exonic
1152459063 17:80431862-80431884 CTTGGAACTCAGGCCAGTGTGGG + Intronic
1153203118 18:2666995-2667017 TATGAATATTATGCCAGTGAAGG + Exonic
1155103652 18:22639641-22639663 CATGAAAATGATGCATGGGTGGG - Intergenic
1155472318 18:26204008-26204030 AAAGAAAGTCATGCCAGTATGGG - Intergenic
1156232161 18:35164213-35164235 GATGAGAAGCATGCCAGTGGAGG - Intergenic
1157149810 18:45205313-45205335 CATGAACTTTAAGCCAGTGTGGG + Intergenic
1157363479 18:47041192-47041214 GTTGATAATCATGCCAGTGTAGG - Intronic
1157736853 18:50057370-50057392 CATGTAAATCATGCCAGGAATGG + Intronic
1158502276 18:58013431-58013453 CCTGAGCATCAGGCCAGTGTTGG + Intergenic
1159874062 18:73790705-73790727 CCTGAAAGTCATGCCAGAGATGG - Intergenic
1164205331 19:23053661-23053683 CATGAACATCCAGCCAGAGTTGG - Intergenic
1164584359 19:29457065-29457087 CCTGACAATCCTGCCAGTATGGG - Intergenic
1165269349 19:34691700-34691722 AATAAATATCATGCCAGAGTAGG + Intergenic
1166155348 19:40907621-40907643 CATGAAAAACATTCCACTATGGG - Intergenic
1168076418 19:53982828-53982850 CAGGAAAACCACGCCTGTGTAGG + Exonic
927929538 2:27035362-27035384 CATGGAAATCAGGACAGTGTGGG - Intronic
928272032 2:29865131-29865153 CAAGAAGATCATGGCAATGTTGG - Intronic
929402021 2:41595000-41595022 CTTCAAAATCATGCCAAAGTGGG - Intergenic
933816056 2:86069661-86069683 CATGAGAACCATTACAGTGTTGG + Intronic
937675087 2:124581271-124581293 AATTAAAATCATGCCAAGGTGGG + Intronic
940254247 2:151712591-151712613 CATGAAAATCTTCCCAGACTTGG - Intronic
940869403 2:158847595-158847617 CATGAAAATCTTGCTGTTGTTGG - Intronic
944171527 2:196784204-196784226 CATCAAAATCCTCACAGTGTAGG + Intronic
944487407 2:200221417-200221439 TAAGAAAATCAAGCCAGTGGGGG - Intergenic
944679714 2:202065749-202065771 CATCAAAATCTCACCAGTGTGGG + Intergenic
946066052 2:216988136-216988158 CATGAAGATGATGGGAGTGTGGG - Intergenic
947820775 2:233067987-233068009 CATAAAAATCATGCTGGTGCTGG + Intronic
1169146534 20:3256143-3256165 CTTGAGCATCATGCCAGTTTTGG - Exonic
1169591135 20:7143947-7143969 AATAAAAAGCATGCCAGTGTGGG - Intergenic
1174706431 20:52660896-52660918 CAAGAAACTCATGAAAGTGTAGG - Intergenic
1174786571 20:53438392-53438414 CATGAAAATTATGCCCTTGCAGG - Intronic
1174926107 20:54761897-54761919 CATTAAAAACAAGCCAGTGATGG + Intergenic
1178723085 21:35027297-35027319 CATGAAAATCAGGCCAATCACGG + Intronic
1179614639 21:42574313-42574335 CAAGAAAATAATGGGAGTGTTGG + Intronic
1180577450 22:16792244-16792266 TATGAAAATTGTGTCAGTGTAGG - Intronic
1182540163 22:31035457-31035479 CATTAGAATCATTACAGTGTTGG + Intergenic
1183561261 22:38575378-38575400 CAAGAAAATGTGGCCAGTGTTGG - Intergenic
954620316 3:51991659-51991681 AATGAAAAGCAAGCCAGTCTAGG - Intergenic
955155163 3:56409388-56409410 TAGGAAAATCATGACTGTGTGGG + Intronic
955783502 3:62511154-62511176 CTTGAAAATCATGCCAACCTTGG - Intronic
957122194 3:76109344-76109366 AATTAAAATCATGGCAGTATGGG + Intronic
958802044 3:98767175-98767197 CCAGATAATCATGCCAGTTTAGG + Intronic
965152336 3:164994284-164994306 CATGAAATTCATGCTAATGGTGG - Exonic
966279501 3:178210962-178210984 CATGAAAATTATGCCAAGATAGG - Intergenic
969019755 4:4131983-4132005 CATGAAAAACTTGCTATTGTTGG + Intergenic
969895960 4:10305000-10305022 CATGAGAAAAATGACAGTGTTGG + Intergenic
971552843 4:27977389-27977411 CATGAGAATTATGCCAAGGTAGG - Intergenic
973579708 4:52331213-52331235 CATGAAATGCATGCCTGTCTGGG - Intergenic
976839136 4:89410819-89410841 CAGGAAAAGCAGGGCAGTGTTGG + Intergenic
979162999 4:117487811-117487833 CATACAAATGATGCCAGTGATGG + Intergenic
980015813 4:127649107-127649129 GATGAAAATGTTGCCACTGTAGG - Intronic
980209937 4:129773927-129773949 CATGAAAAGCAAGCAAATGTAGG - Intergenic
983601155 4:169530219-169530241 CATGAATATCATTACAGTGCAGG + Intronic
987036318 5:14022325-14022347 CATGAAAATGATGTCTGTCTGGG + Intergenic
988214878 5:28258842-28258864 CAGGAAAATGATTCCAGTTTAGG + Intergenic
988721594 5:33884387-33884409 CATGAAAATCAGGCCACTCCTGG + Intronic
991162759 5:63524252-63524274 GATGAAAATCATGACAATTTTGG + Intergenic
993788481 5:92175187-92175209 AATGCAAAACATGCCTGTGTTGG + Intergenic
995702196 5:114948740-114948762 TCTGAAAAACATGGCAGTGTCGG - Intergenic
996524344 5:124462126-124462148 CCTGCAAATCATGGCAGAGTCGG + Intergenic
997308542 5:132859225-132859247 CATGAAAAAAATCCCAGTCTGGG - Intergenic
997505625 5:134414316-134414338 CATGATATTCATGCAAATGTGGG + Intergenic
997624659 5:135323714-135323736 CATGAAAATCATGCATCTGGGGG + Intronic
999470388 5:151849894-151849916 CATGAAATGCATGTCACTGTTGG - Intronic
1001007852 5:168070424-168070446 CATATAAATCAAGTCAGTGTGGG + Intronic
1001369760 5:171186794-171186816 ATAGAAAATCATACCAGTGTTGG - Intronic
1003768803 6:9273757-9273779 CAGGAAATTGATACCAGTGTGGG + Intergenic
1004061297 6:12200534-12200556 CATCAAAACCATGCTAATGTGGG + Intergenic
1004415704 6:15422345-15422367 CATGGAAATCTTCCAAGTGTGGG + Intronic
1007394392 6:41569466-41569488 TATGAAAATGTTCCCAGTGTGGG + Intronic
1008564828 6:52756905-52756927 CTTAAAAATAATGCTAGTGTGGG - Intronic
1008569159 6:52798229-52798251 CTTAAAAATAATGCTAGTGTGGG - Intronic
1009532729 6:64841931-64841953 CATGGAAATCAAGCAAGTGATGG + Intronic
1009722463 6:67489957-67489979 CAGGAAAATCTTTCTAGTGTAGG - Intergenic
1009804337 6:68583549-68583571 TATGAAAAATATGCCTGTGTTGG + Intergenic
1010783628 6:79974149-79974171 CCTCAAAATCTAGCCAGTGTGGG + Intergenic
1012201186 6:96407935-96407957 CATTAAAATCATGCTGATGTGGG + Intergenic
1012233498 6:96786829-96786851 CATGAAAATACTGTCACTGTGGG - Intergenic
1012581681 6:100877982-100878004 GATGAAAAACATGGCTGTGTAGG + Intronic
1013837316 6:114348030-114348052 GATGAACATCATGCCAGAGGTGG + Intergenic
1013837467 6:114349505-114349527 GATGAACATCATACCAGTGGTGG - Intergenic
1014121265 6:117727843-117727865 CATGAAGATTATGCCAGTGGTGG - Intergenic
1014418788 6:121215442-121215464 CATGAAATTGATGGCAGTGGTGG - Intronic
1014781436 6:125569537-125569559 AATGAAAAACATTCTAGTGTGGG - Intergenic
1014914421 6:127128546-127128568 ACTGAAAACCATGCCAGTTTTGG + Intronic
1018255018 6:161909930-161909952 CATGGAAAACATGCCGGTGGGGG + Intronic
1020819714 7:12951839-12951861 CATGAAAATAAATCCAGGGTTGG + Intergenic
1020941161 7:14539346-14539368 CAAGGAAAACATGACAGTGTGGG - Intronic
1021625915 7:22592955-22592977 AATGAAGATCATGTCAATGTGGG + Intronic
1022369379 7:29756662-29756684 CTTGAATGTCATGCCAGTGTTGG - Intergenic
1023114797 7:36852083-36852105 CATGAAAATCCTGACAGAGTTGG - Intergenic
1023455405 7:40333480-40333502 TATGAAAATTAGCCCAGTGTGGG + Intronic
1026326247 7:69313296-69313318 CAGGAAGATAATGCCAGTCTTGG + Intergenic
1028898566 7:96069607-96069629 CATGAAAATCATGCCAGTGTGGG + Intronic
1031890535 7:127288687-127288709 CATAGAAATCATGCTTGTGTTGG - Intergenic
1032060313 7:128718545-128718567 CACGAGAATCATGGCAGGGTAGG + Intronic
1036816734 8:11908070-11908092 CATGAAAGGCTTGCCATTGTAGG + Intergenic
1037513139 8:19603729-19603751 CATAAAGACCATGCCAGTGATGG - Intronic
1040094594 8:43431651-43431673 CATGAAGATCATACAAGTCTAGG + Intergenic
1041346075 8:56899451-56899473 AATGAAAATCAGGGCAGGGTAGG + Intergenic
1041434015 8:57817730-57817752 CATGAAAGTACTGCCAGTGGAGG - Intergenic
1041619581 8:59951127-59951149 TAAGAAAATCAAGCAAGTGTTGG + Intergenic
1041630727 8:60083709-60083731 CCTGAAAAGCAGGCCTGTGTGGG - Intergenic
1042345020 8:67718498-67718520 AATGAAAAAAATGCCTGTGTGGG - Intronic
1044141655 8:88661487-88661509 GATGAAAGACATGCCAGTGATGG + Intergenic
1044270838 8:90241367-90241389 CAGGAAAATCATGCCTGTTATGG + Intergenic
1044708542 8:95032416-95032438 CATGTAAATTATGCAATTGTTGG - Intronic
1050786267 9:9405805-9405827 CATAAAAATGATTTCAGTGTTGG - Intronic
1052251242 9:26399862-26399884 CCTGAAAATCTTGTCATTGTGGG + Intergenic
1053522099 9:38790858-38790880 CATGCAAATGATGAAAGTGTAGG - Intergenic
1054194324 9:62015322-62015344 CATGCAAATGATGAAAGTGTAGG - Intergenic
1054644083 9:67573368-67573390 CATGCAAATGATGAAAGTGTAGG + Intergenic
1055027728 9:71740143-71740165 TATGAAAATCATAGCAGTGGCGG - Exonic
1056210856 9:84363878-84363900 TATGGAAATCAGGCCAGTCTTGG - Intergenic
1056991809 9:91420490-91420512 GATGGAAATCAGGACAGTGTTGG + Intronic
1057667887 9:97060945-97060967 GGTGAGAATCAGGCCAGTGTGGG - Intergenic
1057768013 9:97940506-97940528 CATGATAAACAGGCCAGAGTGGG + Intronic
1058370205 9:104257677-104257699 CTTGAAATTCATGTCAGTCTAGG - Intergenic
1061647058 9:132012503-132012525 CCTGAAAATCATGGAAGTGGTGG + Intronic
1185931853 X:4212363-4212385 CATGAAAATCACTCCATTGCAGG - Intergenic
1186059476 X:5688881-5688903 CATGAGTTTCAGGCCAGTGTGGG - Intergenic
1186735932 X:12463915-12463937 CATGAAAAACAGGCCAGGTTCGG - Intronic
1187525979 X:20055467-20055489 CTTGAAAATCTTGTCAGTGTTGG - Intronic
1188864186 X:35294015-35294037 AATTAGAAACATGCCAGTGTTGG - Intergenic
1189269063 X:39737663-39737685 CATACAAATCATGCAAGTATCGG - Intergenic
1192169575 X:68845929-68845951 CAGGAAAATCCAGCCATTGTGGG - Intergenic
1196518618 X:116644607-116644629 CAAAAAAATCATGCCAATGTGGG - Intergenic
1198159982 X:133998383-133998405 TATGAAAAACATGCCAATTTGGG + Intergenic