ID: 1028900197

View in Genome Browser
Species Human (GRCh38)
Location 7:96090471-96090493
Sequence TATTTCTTTCCTTAATTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 365}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028900193_1028900197 19 Left 1028900193 7:96090429-96090451 CCCATATTTGTTACTATTTACTT 0: 1
1: 0
2: 3
3: 65
4: 720
Right 1028900197 7:96090471-96090493 TATTTCTTTCCTTAATTAGGTGG 0: 1
1: 0
2: 3
3: 28
4: 365
1028900194_1028900197 18 Left 1028900194 7:96090430-96090452 CCATATTTGTTACTATTTACTTG 0: 1
1: 0
2: 5
3: 42
4: 503
Right 1028900197 7:96090471-96090493 TATTTCTTTCCTTAATTAGGTGG 0: 1
1: 0
2: 3
3: 28
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028900197 Original CRISPR TATTTCTTTCCTTAATTAGG TGG Intronic
901621642 1:10593283-10593305 TCTTTCTTTCTTTCCTTAGGTGG + Intronic
901906399 1:12415817-12415839 TATCACTTTCCTTAGTTAGGTGG - Intronic
903494010 1:23752245-23752267 TATTTATTTCCTGACTGAGGTGG + Intronic
903633125 1:24792042-24792064 TTTTTTTTTTTTTAATTAGGTGG - Intronic
904052401 1:27647688-27647710 TATATCTTTCCTCAAACAGGGGG - Intergenic
906762695 1:48390800-48390822 TATTTATTTTCTGGATTAGGTGG - Intronic
907630474 1:56076552-56076574 TATTAGTCTCCATAATTAGGTGG - Intergenic
908094180 1:60719838-60719860 TTTTTATTTCCTTAACCAGGAGG + Intergenic
908238448 1:62169262-62169284 TATTTGTATACCTAATTAGGTGG + Intergenic
908373558 1:63508626-63508648 TATATCTTCCCTTAATTATTGGG - Intronic
908622538 1:66000516-66000538 TTTTTCTTTCCTGAACTAGGAGG + Intronic
908761466 1:67516316-67516338 TTTTTCTTTTTTTAATTAGCTGG - Intergenic
909096951 1:71298942-71298964 TGTTTATTTCCTTAATTGTGAGG - Intergenic
911470821 1:98316194-98316216 TGTTTCTTTCCTTAAATTGAGGG - Intergenic
911876752 1:103175089-103175111 TCTTTCTTTCTTTTTTTAGGAGG + Intergenic
912831829 1:112959459-112959481 TATTTATTTACTTATTTAGATGG - Intergenic
913036834 1:114975750-114975772 TATATCTTTCATTAATTTGATGG + Intronic
913377516 1:118169700-118169722 TATAACTTTCCTTATTTAAGAGG + Intronic
914818220 1:151079064-151079086 TATATCTTTCTTATATTAGGAGG + Intronic
916376073 1:164154521-164154543 TCTTTCATTCATTTATTAGGAGG - Intergenic
917829936 1:178871465-178871487 TATTTATTACATTATTTAGGTGG - Intronic
919447690 1:197729587-197729609 TATTTCTTTCTTGAAGTATGGGG - Intronic
920798276 1:209161648-209161670 TATTTTTTTTCTTAACTGGGTGG - Intergenic
921541348 1:216419863-216419885 TATTTTTTTCCTGAGTTGGGAGG + Intronic
921870944 1:220139369-220139391 TATTTCTGTACTTTATTATGAGG - Intronic
922141863 1:222895029-222895051 TTCTTCTTTCCTTATTTTGGGGG + Intronic
922891130 1:229062596-229062618 TCATTCTTTCCTTCAATAGGGGG + Intergenic
922925076 1:229341900-229341922 CCTTTATTTCCTTAATTAGGTGG - Intronic
922949521 1:229547064-229547086 TTTTCCTTTCCTTAACTGGGTGG - Intronic
923168137 1:231387257-231387279 TCTGTCTTTATTTAATTAGGGGG - Intronic
923929284 1:238675085-238675107 TATTTTTTTCCTTATTTAGCAGG + Intergenic
924032368 1:239898896-239898918 TATTTTTTGCCATAACTAGGGGG + Intronic
924187372 1:241508102-241508124 TCTTTCTTACCTAAATTAGTAGG - Intronic
924268907 1:242311745-242311767 TATGTCTTTCCTCAAATTGGGGG + Intronic
924326910 1:242904224-242904246 TATTTCTTTCACAAATTTGGGGG - Intergenic
924663914 1:246050181-246050203 TCTTTCTTTCTCTAATTAAGAGG + Intronic
924672364 1:246142356-246142378 TTTTTCTTTCCTTATTAAGTCGG + Intronic
1063497422 10:6523287-6523309 TTTTTCTTTTTTTAATTAGCTGG + Intronic
1064414691 10:15138835-15138857 AATTTCTTTTCTTAATTTGGAGG - Intronic
1064694950 10:17955823-17955845 TTTTTCTTTCTTTAATGAGAAGG + Intronic
1065884319 10:30063391-30063413 TTTTTCTTTCTTTAAGCAGGCGG - Intronic
1066111682 10:32202996-32203018 TGTTTTTTTCCTTAACAAGGTGG - Intergenic
1066227997 10:33403342-33403364 TATTTATTTATTTATTTAGGGGG + Intergenic
1066310293 10:34189367-34189389 CATTTCTTTCCTTCTTTATGGGG + Intronic
1066716003 10:38287020-38287042 TATGTCTTTCCTCAAATTGGGGG - Intergenic
1066959341 10:42205950-42205972 TATTTTTTTCTTTAATTACCAGG - Intergenic
1067958375 10:50819130-50819152 TCTTTCTTTCCTTAATGGTGGGG + Intronic
1069107749 10:64404725-64404747 TATTTCTGTTCTTAACTAGGAGG + Intergenic
1070064194 10:73017643-73017665 AATTTCTTTCCTTTTTTAGCAGG - Intronic
1070953964 10:80452870-80452892 TATTTGTTTGTTTAATTAAGAGG - Intergenic
1071112341 10:82174557-82174579 TATTTCAAGCCTTAATTAGTAGG + Intronic
1072063789 10:91844900-91844922 TACTTCTTTTCTAAATTAGCTGG + Exonic
1072940707 10:99761077-99761099 TTTTTTTTTCTTTAATTAGCTGG - Intergenic
1074925436 10:118064948-118064970 TATTTATTTACTTAATTATATGG + Intergenic
1077471848 11:2767193-2767215 TTTTTCTTTGCTTAGCTAGGAGG + Intronic
1079368154 11:19827409-19827431 TATTTGTTTACATAAATAGGTGG + Intronic
1079515378 11:21261413-21261435 TATTTCTTTTATTATTTAGATGG + Intronic
1079906047 11:26248420-26248442 TAGTTCTTTCCCTAATGAGAGGG + Intergenic
1080196724 11:29619447-29619469 TATTTCTTTCATTAAATACTTGG + Intergenic
1080263621 11:30377405-30377427 TATTTCTTTCCTTGACTGGCTGG + Intergenic
1081066076 11:38541146-38541168 TATTTCTTTCTTTACCTACGAGG + Intergenic
1088416612 11:109596427-109596449 TATTTTTTTCCTGAATTTTGGGG + Intergenic
1089208684 11:116786162-116786184 TATTTGTCTCCTTAATTGGTTGG - Intronic
1089521064 11:119063865-119063887 TATTTCTTTCTTTTTTTTGGAGG - Intergenic
1089656395 11:119949997-119950019 TATTTTTTTCCATGATTATGTGG - Intergenic
1090487187 11:127124047-127124069 TATTTCTTTCCTTAATTCTGTGG + Intergenic
1090966729 11:131604705-131604727 TTTTTCTTTCCTTTTTTTGGGGG + Intronic
1092867414 12:12775840-12775862 ATTTTCTTTCTTTAATTAGCTGG + Intronic
1094097352 12:26722090-26722112 TACTTTTTTGCCTAATTAGGAGG - Intronic
1094434584 12:30407485-30407507 TGTTCCTCTCCTTAATTAGCTGG - Intergenic
1095499002 12:42816051-42816073 TATTTCTTTAAATAATTAGGTGG + Intergenic
1095700144 12:45183094-45183116 TATTTCTTTCCTGAATTTTTCGG + Intergenic
1096223255 12:49845994-49846016 AATTTCTTTCATTTATTAGCTGG + Intergenic
1096450118 12:51732776-51732798 TATTTCTTTTATTAATTACTAGG + Intronic
1097579282 12:61433801-61433823 TTTTTTTATCCTTTATTAGGTGG - Intergenic
1097752586 12:63373083-63373105 TATTTCTTTCATCAGTTATGTGG - Intergenic
1098471104 12:70845332-70845354 TATTTCTGTCCTTTTTTTGGGGG - Intronic
1099132566 12:78853969-78853991 TTTTTCTTTCTATGATTAGGAGG + Intergenic
1099361812 12:81711782-81711804 TTTTTTTTTTTTTAATTAGGAGG + Intronic
1100105633 12:91168463-91168485 TATTTTTTTCCTGAGTAAGGAGG + Intronic
1100233231 12:92631593-92631615 TATTTCCATCCCTAATGAGGGGG + Intergenic
1100491253 12:95080466-95080488 TGTTTTTTTTTTTAATTAGGAGG + Exonic
1102943561 12:116964873-116964895 TTTTTTTTTCCTTAATAGGGAGG - Intronic
1103404936 12:120668457-120668479 TATTTCTTTCTTTTTTTAGACGG - Intergenic
1103718191 12:122958679-122958701 TTTTTCTTTTTTTAATTAGCTGG + Intronic
1104168624 12:126258190-126258212 CTTTTGTTTCCTTAATGAGGTGG + Intergenic
1105687119 13:22794671-22794693 TGTTTGTTTGTTTAATTAGGTGG - Intergenic
1106229539 13:27811105-27811127 TATTTATTTATTTATTTAGGAGG - Intergenic
1106277567 13:28227369-28227391 TATTTTGTCCCATAATTAGGGGG + Intronic
1108449060 13:50542090-50542112 TATGTTTTTCCTTGCTTAGGAGG - Intronic
1108778930 13:53803352-53803374 CATTTCTTTCCTAAATTATTGGG - Intergenic
1109061329 13:57624577-57624599 TATTTCTTTCCATAATTCTGAGG - Intergenic
1110866962 13:80407235-80407257 TTTTTCTTTCCTCAACTTGGAGG + Intergenic
1111341004 13:86886107-86886129 TATTTTTTTCCTTAATTATTTGG - Intergenic
1111430194 13:88139191-88139213 TATTTCTTACCTAAATCAGGTGG - Intergenic
1111637940 13:90929885-90929907 TTGTTCTCTCCTCAATTAGGTGG - Intergenic
1111683628 13:91475109-91475131 TCTTTTTTTCCCTAATTATGAGG + Intronic
1111907156 13:94268646-94268668 TATTTCATTCCTAAGTGAGGAGG + Intronic
1113199599 13:107851971-107851993 TATTTTTTTTTTTAATTTGGGGG + Intronic
1113558293 13:111256011-111256033 TATTTTTTTCCTAAAATAGCTGG + Intronic
1114128628 14:19762021-19762043 TATTTTTTTCCTTAGTAATGGGG + Intronic
1115643483 14:35350540-35350562 TAATTCTTTTTTTAATTAGAAGG - Intergenic
1116036408 14:39632501-39632523 TATTTCTTTGATTAGTAAGGAGG + Intergenic
1116585608 14:46699045-46699067 TTTTATTTTCCTTAATTAGGAGG - Intergenic
1116593186 14:46806800-46806822 TAGGTGTTTCTTTAATTAGGGGG + Intergenic
1118520061 14:66573350-66573372 TATTTGTTTACATATTTAGGTGG + Intronic
1118697710 14:68400904-68400926 TTTTCCTTTCCTTAAGTAGAAGG + Intronic
1118731940 14:68674307-68674329 TATTTATTTTTGTAATTAGGAGG - Intronic
1120923016 14:89772234-89772256 TATTTGTTCCCATAATTGGGAGG - Intergenic
1121720783 14:96107227-96107249 TATTTCTCTTCTTAGTTAGCAGG - Intergenic
1123571568 15:21616263-21616285 TATTTTTTTCCTTAGTAATGGGG + Intergenic
1123608186 15:22058854-22058876 TATTTTTTTCCTTAGTAATGGGG + Intergenic
1123963472 15:25432253-25432275 TATTTCTATATTTAATTAGGAGG + Intronic
1124525863 15:30452057-30452079 TATTTCTCACCTTAATTAATGGG + Intergenic
1124684964 15:31774760-31774782 TCTTCCTTTCCTAAATTAAGGGG - Intronic
1124772792 15:32555628-32555650 TATTTCTCACCTTAATTAATGGG - Intergenic
1126922005 15:53537312-53537334 TATTTCTTTCCTTTTTTAATTGG + Intronic
1127710637 15:61593994-61594016 TTTTGCTTTACTTAATTTGGAGG - Intergenic
1128532135 15:68461682-68461704 TATTTCTTTTCTTAGTTCAGGGG + Intergenic
1129952606 15:79605408-79605430 TAATTCTTTCTTTAGTCAGGCGG + Intergenic
1131984148 15:98024310-98024332 TATTTCATCCCTTAGTTAGTAGG - Intergenic
1132416172 15:101620622-101620644 TCTTTTTTTCTGTAATTAGGTGG - Intergenic
1202980422 15_KI270727v1_random:350652-350674 TATTTTTTTCCTTAGTAATGGGG + Intergenic
1134478841 16:14599957-14599979 TATATATTTTTTTAATTAGGAGG - Exonic
1137530286 16:49275137-49275159 TAATTGTTGCCTTAATGAGGTGG - Intergenic
1137791079 16:51175395-51175417 TATTTCTTTCCTTCTTCTGGAGG - Intergenic
1138837741 16:60458914-60458936 AATTTATTTCCTTATTTTGGTGG + Intergenic
1139049574 16:63107346-63107368 TATTTTCTTACTTATTTAGGGGG - Intergenic
1140265767 16:73419168-73419190 TACTTCTTTCCTTCATTAGCCGG - Intergenic
1140536420 16:75714061-75714083 TCTTTCTTTTCTTAATGTGGAGG + Intronic
1141554633 16:84828911-84828933 TATATCTTTTGTTAATTAGCTGG + Intronic
1142566273 17:842207-842229 TCTTTCTTTCCTTGATGAAGTGG - Intronic
1143227527 17:5319369-5319391 TATTTTTTTCCTTTTTGAGGTGG + Intronic
1144350764 17:14394040-14394062 TATTACTTTCCTTAAAAAGGTGG + Intergenic
1144560152 17:16314733-16314755 TGTTTCTTTCCTGAATTTGAAGG - Intronic
1145214210 17:21040458-21040480 TATTTCTTTCAAAATTTAGGTGG - Intronic
1145812084 17:27770480-27770502 TATTTATTTATTTACTTAGGTGG - Intronic
1146052547 17:29565487-29565509 AATTTCTTTTTTTAATTAGCCGG - Intronic
1146214245 17:30966120-30966142 TAATCCTTTCCTTATTCAGGGGG - Intergenic
1148618856 17:49019473-49019495 TATTTCTTTCCATAATAAAAAGG - Intronic
1148941711 17:51219608-51219630 GATGTATTTCCTTAATTTGGAGG + Intronic
1149761482 17:59234670-59234692 AATTTCTTTTTTTAATTAGTTGG + Intronic
1149825761 17:59826483-59826505 TAATTCATTCATTAAATAGGAGG + Intronic
1150508323 17:65721874-65721896 TGTTTCTTTCCTTCAATAGTTGG - Intronic
1150924656 17:69520150-69520172 TATTTCTTTCTTGAATTTTGGGG - Intronic
1153099412 18:1449561-1449583 TATTTATTTCTTTATTTTGGAGG + Intergenic
1154073415 18:11176528-11176550 TATTACTATCCTAAATGAGGAGG - Intergenic
1155782673 18:29857792-29857814 TGTTTCTTTCCTTAATCCAGAGG + Intergenic
1156800050 18:41099709-41099731 TTTTTCTTTCCTTAAACAAGTGG + Intergenic
1156967655 18:43114957-43114979 TGTTTGTTTCTTTCATTAGGAGG - Intronic
1157830166 18:50850335-50850357 AATCTCTTTCCTTAATCAGTTGG - Intergenic
1160049999 18:75424421-75424443 GATTTCTTTCCATTATTAAGGGG + Intronic
1162467938 19:10853906-10853928 TTTTTTTTTTTTTAATTAGGAGG + Intronic
1167547383 19:50136261-50136283 TATTTCTTCCATAAATTATGGGG - Intergenic
1167829347 19:52006524-52006546 TATTTATTTACTTAATAGGGAGG - Intronic
925392817 2:3509721-3509743 TTTTTCTTTCCTTAGTACGGGGG - Intronic
925727812 2:6890966-6890988 TGTATCTTTCATTAATAAGGAGG - Intronic
925964577 2:9052158-9052180 AAATTATTTACTTAATTAGGAGG + Intergenic
927228857 2:20799779-20799801 TATTTTTTGGCTTCATTAGGAGG - Intronic
928523988 2:32121139-32121161 CATTTCTTTCTTTTTTTAGGTGG + Intronic
929184131 2:39075460-39075482 TATTTCTTTCCTTCTTTTAGAGG - Intronic
930390332 2:50752908-50752930 TATTACATTGCTTAATTTGGGGG - Intronic
932786893 2:74613490-74613512 TTTTTCTCTCCCTACTTAGGTGG + Intronic
933884070 2:86701628-86701650 GATGTCTTTCCTTAATTAAATGG - Intronic
934542501 2:95187540-95187562 TGTTTATTTCTTAAATTAGGTGG + Intergenic
935006768 2:99086732-99086754 TTTTTCTTTCCTTATTTACTTGG - Intronic
935547679 2:104418044-104418066 TATTTCTTCTCTTAATTATTAGG + Intergenic
937107054 2:119325613-119325635 CATTTCTTTCCTTTTTTTGGAGG - Intronic
939618821 2:144393005-144393027 TATTACTTTTCTAAATAAGGTGG + Intronic
939896306 2:147795329-147795351 CATTTCTTTGTTTAATTAGCTGG + Intergenic
940279509 2:151975075-151975097 TATTTCTTACCTCATTTTGGCGG - Intronic
940461755 2:153972785-153972807 TATTTCTTCCTTTAATGAAGTGG + Intronic
940769904 2:157828669-157828691 CATTTTTTTCTTTAATTAGTGGG - Intronic
940924689 2:159351197-159351219 AATTTCTTTCCTTAATTATGTGG - Intronic
941223637 2:162816556-162816578 TAATTCTTTCCTATATTAGGAGG - Intronic
943251451 2:185525485-185525507 TATTTCTTTTATTGATTTGGGGG + Intergenic
944287453 2:197967565-197967587 TATTTCTTTATTTACTTTGGGGG + Intronic
944920820 2:204411370-204411392 GATTTCTTTCCTTAATAAACTGG - Intergenic
945061759 2:205915410-205915432 TATTTCTTTGCTAATTTAGAAGG - Intergenic
946628445 2:221640660-221640682 TATTTATTTACTTAATTTTGAGG + Intergenic
946764358 2:223026101-223026123 TATTTATTTATTTATTTAGGTGG - Intergenic
947358199 2:229318606-229318628 TAGCTCTTTCCTAAATAAGGTGG + Intergenic
947457338 2:230266994-230267016 TATTTCTTTCCCTAATCCTGAGG - Intronic
947553758 2:231068870-231068892 TTTTTCTTTCCTTATTAAGTTGG - Intronic
947887776 2:233588627-233588649 TTTCTCTTTCCTTATTTAGAAGG + Intergenic
947893997 2:233651645-233651667 TTTCTCTTTCCTTATTTAGAAGG + Intronic
948165934 2:235862662-235862684 TTTTTCTTTCTTTAATCAGGAGG + Intronic
949051811 2:241901745-241901767 TATTCCTTTCCGTTTTTAGGTGG - Intronic
1169051295 20:2580379-2580401 TACTTTGTTCCTTAATTAGTAGG + Intronic
1169305861 20:4489828-4489850 AGTTTCTTTCATTAAATAGGTGG - Intergenic
1170171440 20:13417914-13417936 AATTTCTTTCCTTATTGAGACGG + Intronic
1170199522 20:13727680-13727702 TCTTTCTTTCCTCCATTATGTGG - Intronic
1170251199 20:14285092-14285114 TTTTTCTTTCCTTTCTGAGGGGG - Intronic
1170385607 20:15813033-15813055 TATAGCTTTCCATAATAAGGGGG - Intronic
1171241593 20:23572283-23572305 TATTTCTTTCCTTTAATATCTGG - Intergenic
1174368510 20:50070856-50070878 TATTTTTTTTTTTAATTAGCCGG - Intergenic
1174579139 20:51558665-51558687 TATTTATTTGCTGAATTATGGGG - Intronic
1175194400 20:57232717-57232739 GATTTCCTTCATTAATTAGTTGG + Intronic
1175650096 20:60714053-60714075 TTTTTCCTTCCTTAGTAAGGGGG - Intergenic
1175896986 20:62341719-62341741 TTTTTCTTTCTTTAGTTGGGAGG - Intronic
1176303626 21:5111965-5111987 TCTTTCTTTTTTTAATAAGGCGG + Intergenic
1179598998 21:42463250-42463272 CCTTTGTTTCCTTACTTAGGGGG - Intergenic
1179853405 21:44149985-44150007 TCTTTCTTTTTTTAATAAGGCGG - Intergenic
1180506703 22:16018037-16018059 TATTTCTTTTCTAACATAGGCGG + Intergenic
1183033650 22:35124343-35124365 TCTTTCTTTCCTCCAGTAGGTGG + Intergenic
1183446031 22:37855873-37855895 TATTTCCTTCTATAATTTGGGGG + Intronic
1184203921 22:42988453-42988475 TATTTTTTTCTTTAATTACTAGG - Intronic
1184823417 22:46930458-46930480 TATTTATTTACTTATTTAGACGG + Intronic
1203331952 22_KI270739v1_random:3731-3753 TATTTCTTTTCTAACATAGGCGG - Intergenic
949121076 3:385051-385073 TATTTCTTTCCTTGAATGTGTGG + Intronic
949436003 3:4030019-4030041 TGTTTTTTTCCTTTTTTAGGAGG + Intronic
951718757 3:25675627-25675649 TTTTTATTTGCTGAATTAGGTGG + Intergenic
951953752 3:28230779-28230801 TATTTCTTTCTTTAATTTGTGGG + Intergenic
951994040 3:28706944-28706966 TTTTTCTTTCCTGGATTAAGCGG + Intergenic
952087428 3:29842643-29842665 AATATCTTGCCTTACTTAGGAGG + Intronic
952109403 3:30105230-30105252 TATTTATTCCCTTAATTATTAGG - Intergenic
953268686 3:41418322-41418344 TACTTTTTTTCTTAATTTGGCGG + Intronic
955425634 3:58786765-58786787 TTTTTCTTTCCTTATTAAGTCGG - Intronic
955688695 3:61569189-61569211 TATTTGTTTTCTAAACTAGGTGG + Intronic
956108516 3:65846912-65846934 TGTTTCTTTCCTTTGTTTGGGGG - Intronic
956342978 3:68247300-68247322 TTTTTCTTTCCTAAAGCAGGAGG - Intronic
957448605 3:80346702-80346724 TATTTATTTATTTATTTAGGCGG + Intergenic
957702244 3:83729381-83729403 TTTTTCTTTCCTTTTTTAGGGGG + Intergenic
957755019 3:84473764-84473786 TATTTCTTTCGTTAATTCCTAGG - Intergenic
957764473 3:84604324-84604346 TATTTATTTCCTTATTTAATTGG + Intergenic
958428981 3:94015443-94015465 TATTTCTTTCCCTATTTAAATGG - Intronic
959772244 3:110112183-110112205 TATTTCTTACCATAACTGGGAGG + Intergenic
960134182 3:114089213-114089235 TATTTCTTTCCTGAAATATCTGG - Intergenic
960524103 3:118689975-118689997 TATCTCTTTCTTTAATCAGTTGG - Intergenic
960795608 3:121483802-121483824 TAATGCTCTACTTAATTAGGTGG + Intronic
961202718 3:125056945-125056967 TCTTTCTTCACTTAATGAGGTGG - Intergenic
961965966 3:130903210-130903232 TATTCCATTCATTAATTAGTTGG + Intronic
964289401 3:155159823-155159845 TATATCTTTGCTCAATTAGCTGG + Intronic
965178621 3:165369650-165369672 TATTGCTTTCTTTAATTATGAGG - Intergenic
965938729 3:174148589-174148611 GATTTATATACTTAATTAGGAGG - Intronic
966190142 3:177265077-177265099 TTTTTCTTTTTTTAATTAGCCGG - Intergenic
966268238 3:178072382-178072404 TTTTTCTTTCCTTTCTTTGGGGG - Intergenic
966675810 3:182588150-182588172 TATTGCTTTCCTGATTTGGGGGG - Intergenic
967455387 3:189680466-189680488 TATTTGTTTCTTTATTTAGGCGG - Intronic
967683785 3:192396559-192396581 TATTTCTTTCTTCCATGAGGTGG + Intronic
967707084 3:192663586-192663608 TATAGCTTTCCTGATTTAGGGGG + Intronic
968329142 3:197849731-197849753 CATTTGTTTTCTTAATCAGGAGG + Intronic
968943190 4:3649995-3650017 CATTTGTTTCCTTTGTTAGGTGG + Intergenic
969118758 4:4891315-4891337 TATTTTTTTCCTTTATCATGGGG + Intergenic
969141234 4:5075314-5075336 AATTTGTTTTCTTAATTTGGTGG + Intronic
970965995 4:21928685-21928707 TAATCCTTTGCTTAATCAGGGGG - Intronic
970990939 4:22212381-22212403 TATTTCCTTCTTGAATAAGGAGG - Intergenic
971515110 4:27475901-27475923 TATCTGTCTCCTTAATTTGGGGG - Intergenic
972109360 4:35537544-35537566 TATTCTTTTTGTTAATTAGGAGG + Intergenic
972922112 4:43956874-43956896 GATTTCTTTCATGAATTAGCTGG + Intergenic
973033005 4:45367733-45367755 TATTTTTTTCCTTTATTAAAAGG + Intergenic
973218217 4:47695889-47695911 TTCATCTTTCCTTAATTATGTGG - Intronic
973335927 4:48956322-48956344 TGTTTCTTTCCTTACTCAGAAGG - Intergenic
973786407 4:54336671-54336693 TATTTCTCACTTTAGTTAGGAGG + Intergenic
974393307 4:61302174-61302196 TTTTTGTTTCCTAGATTAGGTGG + Intronic
975934347 4:79560494-79560516 TACTTCCTTCCTTAATTAGTTGG - Intergenic
976838097 4:89398942-89398964 TATTTTTTTGGTTAATTATGAGG + Intergenic
977730760 4:100348903-100348925 TTTTTCTTTTCTTATTTAGTTGG - Intergenic
978849869 4:113321680-113321702 TTTTTCTTTAATTAATTGGGTGG + Intronic
979017591 4:115453820-115453842 TCTTTCTTTCCTTAACTCAGTGG + Intergenic
981908092 4:149945907-149945929 TATTTCTTTTGATAATTTGGAGG - Intergenic
982452183 4:155566268-155566290 TATAATTTTCCTAAATTAGGTGG + Intergenic
982878634 4:160681151-160681173 TATATTTTTATTTAATTAGGTGG + Intergenic
982988776 4:162244388-162244410 TATATCTTTACTTAATTAGGGGG - Intergenic
983980375 4:173988485-173988507 TATTTTTTTCCTGAAATGGGTGG + Intergenic
984502080 4:180569134-180569156 TACTTGTTTGCTTAATTACGAGG + Intergenic
984848282 4:184126986-184127008 TATTTTTTCTCTTAATTATGGGG - Intronic
984995697 4:185427753-185427775 TATTTCTTTGCTTATTAAGATGG - Intronic
985857759 5:2443373-2443395 TATTTCTGTCCAAACTTAGGTGG - Intergenic
986899574 5:12414649-12414671 TATTTCCTTGTTTATTTAGGTGG - Intergenic
987529927 5:19104453-19104475 TTTTTCTTTCCTTCATTACCAGG - Intergenic
988134244 5:27149079-27149101 TATTTCTTTACTTAACTTGATGG - Intergenic
988441607 5:31240337-31240359 TATTTCTTTCTTCAATTTGCGGG + Intronic
988907555 5:35804774-35804796 TAACTATTTCCATAATTAGGGGG - Intronic
989138927 5:38182784-38182806 AATTTCTTTCCTTAAAGATGTGG + Intergenic
990880452 5:60532037-60532059 TATTTCTTCCTTTGATTATGTGG + Intergenic
991107516 5:62861338-62861360 TATTTCTCTCCTTAAGTGGATGG + Intergenic
991194317 5:63914559-63914581 TATTTCTTTCTTAAAATAAGAGG - Intergenic
991577583 5:68121626-68121648 TATTTCTTTTCTTAATGATGCGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
992429680 5:76696708-76696730 CATTTCTTTCTTTAGTTTGGGGG + Intronic
992466144 5:77007214-77007236 TCTTACTTTCCTTGATTAAGAGG - Intergenic
992506476 5:77392112-77392134 TAATTGTTTCCATAATTATGTGG + Intronic
992512600 5:77453626-77453648 TATTTTTATCCTGAATCAGGAGG - Intronic
992534233 5:77682391-77682413 CATTTCTTTACTTATTTATGAGG + Intergenic
992739953 5:79763548-79763570 TATTAGTTTCCTGAGTTAGGTGG - Intronic
993229786 5:85219567-85219589 TATTTTTTTCCCTAAGTTGGTGG + Intergenic
993354048 5:86884094-86884116 TTTTTCTCTCCTTGATTAGGTGG - Intergenic
993555489 5:89331544-89331566 TTTTTCTTTTTTTAAGTAGGTGG + Intergenic
994949322 5:106437647-106437669 CATTTCTTTACTTAATTATTGGG + Intergenic
997355279 5:133258794-133258816 TATTTCTTTCCCTTCTGAGGGGG - Intronic
998301077 5:141021008-141021030 TTTTTATTTTCTTAATTAGAAGG - Intergenic
998306116 5:141078632-141078654 TATTTCTTCCTTTAATTTGAAGG + Intergenic
998659206 5:144217335-144217357 TTTTTTTTTCCTTAAATAGAGGG + Intronic
999005433 5:147971479-147971501 TATTTATTTACTTAATTAAATGG + Intergenic
999463413 5:151776968-151776990 TTTTTCTTTCATTAATTACCAGG + Intronic
999839912 5:155413785-155413807 GATTTCTTCCCTCAATAAGGAGG - Intergenic
1000428647 5:161123437-161123459 TACTTCTTTCCTTTGGTAGGGGG + Intergenic
1000734468 5:164881919-164881941 AATTTCTTTACTTAATTTGCTGG + Intergenic
1003834501 6:10055850-10055872 TATTTCCTTCCTAAAATTGGGGG + Intronic
1004856840 6:19759591-19759613 TATCTCTTCCATTATTTAGGTGG + Intergenic
1005604866 6:27466668-27466690 TATTTTTTTTTTTAATTGGGGGG - Intronic
1007638565 6:43316848-43316870 TATGTCTATCATTAATTATGTGG + Intronic
1009047572 6:58248650-58248672 TATTACTTTCCATATTGAGGGGG + Intergenic
1009176596 6:60467503-60467525 TCTTTCTTTCCTTTAGTTGGGGG - Intergenic
1009223606 6:61004091-61004113 TATTACTTTCCTTATTGTGGGGG + Intergenic
1009297642 6:61973580-61973602 TCTTTCTTTCCTGCATTAGTTGG - Intronic
1009395766 6:63198553-63198575 TATTGCTTTCAATAATTTGGAGG - Intergenic
1009454315 6:63837531-63837553 TATCTCTTTGCCTAATTAGAAGG - Intronic
1010408595 6:75535049-75535071 TTTTTCTTTCCTTATTAAGTTGG + Intergenic
1010845082 6:80696694-80696716 TATTTCTTTCCAGAACTAGTGGG - Intergenic
1011110938 6:83836133-83836155 CATTTCTTTGCTGAATTAGAAGG + Intergenic
1011815128 6:91180388-91180410 TTTTTCTTTCTTTTTTTAGGGGG - Intergenic
1012170668 6:96014246-96014268 TATTTTTTCCCTAAATAAGGAGG + Intergenic
1014499547 6:122168770-122168792 TATATGTTCCCTTGATTAGGAGG + Intergenic
1014630261 6:123780882-123780904 GATTTCTTTCATTATGTAGGTGG + Intergenic
1014762593 6:125373566-125373588 TATTTCTTTCCTAATTTAGCAGG - Intergenic
1014888021 6:126805803-126805825 TATTGCTTTACTTAATTTGGGGG + Intergenic
1015384460 6:132606276-132606298 TATTTATTTATTTAATTTGGAGG - Intergenic
1015710429 6:136133409-136133431 TATTTCTTTTCTGAATTTGTTGG - Intronic
1015987168 6:138896099-138896121 TTTTTTTTTCCTTAATGAGATGG + Intronic
1017555500 6:155561957-155561979 TATTTCATTCCTTTTTTAGCTGG + Intergenic
1018008189 6:159642758-159642780 TTTTTCTTTCCCTATTGAGGAGG - Intergenic
1023098199 7:36685005-36685027 TATTGTTTTCCTTCATCAGGAGG - Intronic
1023253198 7:38287045-38287067 TATTTGTTTAATTAATTGGGAGG + Intergenic
1023345429 7:39266528-39266550 TATTTCTTTCTCTTTTTAGGGGG + Intronic
1023629901 7:42153805-42153827 TATTTCTTTTCTTAAGGATGGGG - Intronic
1024304471 7:47915716-47915738 TTTTTCCTTCCTTAATTGGTTGG - Intronic
1024513420 7:50221002-50221024 TATCTCTTTACTTCATTACGTGG + Intergenic
1026435713 7:70395502-70395524 TATTTCCTTCCTTTATCAGTTGG - Intronic
1026682540 7:72478400-72478422 TATATTTTTTCTTAATTAGATGG + Intergenic
1027630001 7:80592323-80592345 TATTTAATTTCTTAATTATGAGG - Intronic
1027810426 7:82889380-82889402 TATTTCTTTGATTAATTATCAGG - Intronic
1028900197 7:96090471-96090493 TATTTCTTTCCTTAATTAGGTGG + Intronic
1029065061 7:97841056-97841078 TATTTGTTTGTTTATTTAGGAGG - Intergenic
1029066679 7:97856813-97856835 TATTTCTTTATATAATAAGGTGG - Exonic
1029655459 7:101921459-101921481 TATTTATTTACTTATTTATGAGG + Intronic
1029978591 7:104857245-104857267 TTTTCCTTTCCATAATAAGGCGG + Intronic
1030023236 7:105296355-105296377 TATTTATCTCCTAAGTTAGGAGG - Intronic
1030550136 7:110948022-110948044 AATGTTTTTCCTTATTTAGGGGG - Intronic
1031488449 7:122358480-122358502 TTTTTCTTTCATGAATTATGTGG + Intronic
1032928244 7:136634781-136634803 TCTTTATTTCCTTTATTTGGTGG + Intergenic
1035371910 7:158385274-158385296 TCTTTCTTGCCTTAATTGGTTGG - Intronic
1035882800 8:3260495-3260517 AATGTTTATCCTTAATTAGGTGG - Intronic
1037063770 8:14549794-14549816 TGTTTCTTTCCTTATTTATGTGG - Intronic
1037652931 8:20856174-20856196 CTATTCTTTCCTTACTTAGGTGG + Intergenic
1039251605 8:35671212-35671234 TATTTGTTTCCTTAATTGCTAGG + Intronic
1040930449 8:52729300-52729322 TATCTCTTTCCTTAAATCAGTGG - Intronic
1043298118 8:78692552-78692574 ACTTTCTTTCCTTTTTTAGGAGG + Intronic
1043704566 8:83331957-83331979 TATTTCTTTCCTCCTTTAGCAGG + Intergenic
1043930436 8:86084343-86084365 TTTTTCTTTCCTTTATTAATGGG + Intronic
1044421596 8:92002161-92002183 TATTTCTTTCCTAAAATATTAGG - Intronic
1044500227 8:92946271-92946293 TTTTTCTTTCCATATTTAGGGGG - Intronic
1045431519 8:102119235-102119257 AATTTCTTTCCTTTTTAAGGTGG - Intronic
1046995032 8:120509608-120509630 TATTTCTTTCTTTTTTTGGGGGG - Intronic
1047109003 8:121767703-121767725 TATTTCTTGTGTTAATTAGTGGG + Intergenic
1047732854 8:127740379-127740401 TATTTCCTTTCTTAAAGAGGAGG + Exonic
1048559702 8:135520600-135520622 TGTTTCTTTCCTCAATGGGGTGG - Intronic
1049429864 8:142556351-142556373 TATTTCTTTCTTTATTTTAGAGG + Intergenic
1050531534 9:6594193-6594215 TATCTCTTTCATTAATAATGAGG + Intronic
1050740755 9:8817463-8817485 TTTTTCTTTTTTTAATTAGCTGG + Intronic
1051125802 9:13804364-13804386 TATCTGTTTCCTTATTCAGGAGG - Intergenic
1051378357 9:16428746-16428768 TACTTCTTTTATTAACTAGGGGG - Intronic
1051498580 9:17752493-17752515 TATTTATTTACTTACTTATGTGG + Intronic
1051516994 9:17940808-17940830 TATTTCTTTCTTTTTTTTGGGGG - Intergenic
1051556316 9:18386521-18386543 AATTTCTTTATTTAATAAGGGGG + Intergenic
1055534270 9:77221166-77221188 TTTTTCTTTTTTTAACTAGGTGG + Exonic
1057120177 9:92564437-92564459 TATTTCTTTACTAAGGTAGGGGG + Intronic
1058278107 9:103073570-103073592 GAATTGTTTTCTTAATTAGGGGG + Intergenic
1058549120 9:106094193-106094215 TATTTCTTTCCTTATTTCACTGG + Intergenic
1059377387 9:113895011-113895033 TATTTCTTTTCTTAGTGAGAAGG + Intronic
1060677249 9:125526658-125526680 TCTTTCTTTCCTTACTTATGTGG - Intronic
1060760527 9:126244348-126244370 TGTTTCTTTACTTATTTGGGGGG + Intergenic
1061650801 9:132048421-132048443 TAATTTTTTCCCTAATAAGGAGG - Intronic
1186616467 X:11193606-11193628 TATTTCTCCCCTTAGTTGGGTGG + Intronic
1187046068 X:15648261-15648283 TATTTCTTTCCTTTAATCTGTGG - Intronic
1187231807 X:17430446-17430468 TCTTTCTTTCCTTATTTATTGGG + Intronic
1187988788 X:24846854-24846876 TAATTCATTCCTCAATTGGGCGG + Intronic
1189702787 X:43729313-43729335 TATTTGTTTCCTTCATTCAGAGG + Intronic
1190559860 X:51676607-51676629 GATTTCTTTCCTTTTTAAGGAGG + Intergenic
1190564431 X:51716714-51716736 GATTTCTTTCCTTTTTAAGGAGG - Intergenic
1190706466 X:53032416-53032438 TATTTTTTTCCTTAAATATTTGG - Intergenic
1190768565 X:53496372-53496394 TGTGTCTTTCCTTGATTTGGAGG - Intergenic
1191077795 X:56474082-56474104 TCTTTCTTTCCTTATTGAAGTGG + Intergenic
1192239102 X:69315306-69315328 CATTTCTTCCCTTACTGAGGAGG - Intergenic
1193758603 X:85438946-85438968 TTTTCCTTTCTTTATTTAGGGGG + Intergenic
1194248838 X:91547403-91547425 TCTTTCTTTCCTTAAATACAAGG - Intergenic
1195116904 X:101708083-101708105 TATTTATTTCCTTACTATGGTGG + Intergenic
1195627015 X:107014329-107014351 TATTGCTTTCCTTAGGTGGGTGG + Intergenic
1195663314 X:107403918-107403940 TATTTATGTCCTTAATTAATGGG + Intergenic
1197915722 X:131532459-131532481 TGTTTTGTTCCTGAATTAGGAGG - Intergenic
1198677330 X:139144653-139144675 AATTTCTTTCCTTAACTAATGGG - Intronic
1198810345 X:140529894-140529916 TATTTCTTTTCTTAAGGAAGTGG + Intergenic
1200567848 Y:4788939-4788961 TCTTTCTTTCCTTAAATACAAGG - Intergenic
1201224351 Y:11803146-11803168 TATTTCTTTCACAAATTTGGGGG - Intergenic
1201265497 Y:12202669-12202691 TATTTATTTACTTACTTAGAGGG - Intergenic
1201675061 Y:16571904-16571926 AATTCCTTTCATTAATTAGAAGG + Intergenic