ID: 1028901173

View in Genome Browser
Species Human (GRCh38)
Location 7:96101886-96101908
Sequence GAGATTGGTGCCACTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028901173 Original CRISPR GAGATTGGTGCCACTCTTAA AGG Intronic
908423406 1:63981439-63981461 CAGATTGGTGCCCATTTTAAGGG + Intronic
909827333 1:80142700-80142722 GAGGATGGTGCCACTCTCAGTGG - Intergenic
910160574 1:84267966-84267988 GTGAATGGTACCATTCTTAAAGG - Intergenic
911172741 1:94786056-94786078 GAGAATGGTGCCACTATCAAAGG + Intergenic
911943874 1:104081528-104081550 GGGATGGGTGCCAGTCTTAAAGG + Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923843457 1:237700910-237700932 GATATTTGAGCCACTCTAAAAGG - Intronic
923982243 1:239338233-239338255 GAGATTGATGCCACCATAAAAGG - Intergenic
1067819951 10:49519811-49519833 GAGCTTGGTGACATTCTTCATGG - Intronic
1068217351 10:53999767-53999789 GAGATTTTTGCCACCCTGAAGGG + Intronic
1068480546 10:57584214-57584236 GTGATTGTTACAACTCTTAAAGG - Intergenic
1068802458 10:61157639-61157661 AAGATTGTTTCCATTCTTAAGGG - Intergenic
1072048281 10:91678893-91678915 GGGATTGGTGCCCCTATAAAAGG + Intergenic
1074606849 10:114980348-114980370 GAGATTGGAGCCACTATGATGGG - Intergenic
1074891435 10:117739436-117739458 GATTGTGGTGCCACTCTAAATGG + Intergenic
1076569395 10:131422538-131422560 GAGATTATTGCCACTATCAAAGG - Intergenic
1077954147 11:6995309-6995331 GAGATTTAAGCTACTCTTAAGGG - Intergenic
1080129047 11:28771331-28771353 GTGATTGGTGCCAGTATAAAAGG + Intergenic
1080805312 11:35647869-35647891 GGGCTTGGTGCCATTCTCAAGGG - Intergenic
1086265246 11:84990376-84990398 GAGATTAGTGCCCCTATAAAAGG + Intronic
1088363019 11:109010964-109010986 GAAATTGGTTCCACACATAAAGG - Intergenic
1091957500 12:4659553-4659575 TGGTTTTGTGCCACTCTTAAAGG + Intronic
1092125769 12:6074050-6074072 GAGTTTGGTGTCACTCTGAAAGG - Intronic
1092412409 12:8263847-8263869 GAGAGAGGTCCCATTCTTAAGGG + Intergenic
1097439011 12:59586701-59586723 GAGATTAGTGCCACCCTTAAAGG - Intergenic
1099297065 12:80841432-80841454 GAGATTGGTCCAGCTCTTGAGGG - Intronic
1103836363 12:123824258-123824280 AAGAGTGGAGTCACTCTTAAGGG + Intronic
1105848693 13:24315760-24315782 GTGATTGGAACCACTCTTCAAGG - Intronic
1108258972 13:48638123-48638145 GAGATTAGTGCCCTTCTGAAGGG + Intergenic
1116132002 14:40866424-40866446 GAGATTAGTGCCACCATCAAGGG - Intergenic
1119214091 14:72855390-72855412 TAAATTGGAGCCACTCATAATGG - Intronic
1120082151 14:80228519-80228541 GAGATTAGTGCCACCATCAAGGG - Intronic
1128552049 15:68604295-68604317 GAAATTGGTTCCATTCTTCATGG + Intronic
1131772215 15:95750717-95750739 TGGCTTGGTGCCATTCTTAAAGG - Intergenic
1132030203 15:98432885-98432907 GAGATTTGAGCCATTCTTAGTGG - Intergenic
1138553890 16:57761244-57761266 GAGGGTGGTGCCACTCCTCATGG - Intronic
1138685717 16:58723821-58723843 GCTATTGGTGTCCCTCTTAAAGG + Exonic
1139018802 16:62723262-62723284 GAGATTGGTGCTGCCCTAAAAGG - Intergenic
1144269805 17:13604707-13604729 AAGCTTGCTGCCACTCTCAAGGG - Intergenic
1149932391 17:60769316-60769338 GAGAGTGAGGCCACTCTTAGTGG + Intronic
1155231378 18:23778449-23778471 AACATGGGTGCCACTTTTAAGGG + Intronic
1156027437 18:32670850-32670872 GGAATTGGTGCCACTATAAAAGG + Intergenic
1164453307 19:28385141-28385163 GGGATTAGTGCCACCCTTAAAGG + Intergenic
1166848500 19:45745437-45745459 GGGAATGGTGCTACTCTGAACGG + Intronic
1168690396 19:58373222-58373244 CTGATTAGTGCCACTCTTGAGGG - Intronic
927281171 2:21308145-21308167 GAGATTAGTGTCATACTTAAAGG + Intergenic
933593583 2:84260477-84260499 GAGAATGGTGCATCTCTTAGGGG + Intergenic
936592138 2:113814191-113814213 GGGATTGGTGCCATTATAAAAGG - Intergenic
939139300 2:138334678-138334700 GAGAATGTTGCCAATCTAAAGGG + Intergenic
940093825 2:149951610-149951632 GGGATTGATGCCACTATAAAAGG - Intergenic
940968500 2:159867833-159867855 GAGATCTTTGCAACTCTTAATGG - Intronic
943239335 2:185363572-185363594 GAGATTAGTGCCACTCTAATTGG - Intergenic
944183350 2:196921023-196921045 GTAATTGGTTTCACTCTTAATGG - Intronic
945672095 2:212814609-212814631 CAGATTGGTGCCACAATCAAAGG - Intergenic
946550391 2:220794914-220794936 AGAATTGGTGCCATTCTTAAAGG - Intergenic
946718312 2:222576941-222576963 GAGCATGGTGTCATTCTTAAAGG + Intronic
947040104 2:225908671-225908693 GATATTATTACCACTCTTAAGGG - Intergenic
947833227 2:233156623-233156645 AAGAGTGGAGCCACTCCTAATGG - Intronic
1171421104 20:25018189-25018211 GGGATTGGTGCCATTATAAAAGG + Intronic
1175507921 20:59499343-59499365 GAAATTGTAGCAACTCTTAAAGG + Intergenic
1178161489 21:29921401-29921423 CAAATTGTTGCCATTCTTAATGG + Intronic
1178763434 21:35426354-35426376 GGGATTGGGGCCATTTTTAAAGG + Intronic
1180253804 21:46607953-46607975 GAGATTAATGCCACCATTAAAGG + Intergenic
1180930261 22:19585650-19585672 GAGAGTGCTACCACTGTTAAAGG + Intergenic
1184638832 22:45857999-45858021 GAGATGAGTGCCACCATTAAAGG - Intergenic
949380972 3:3445495-3445517 GGGTATGGTGCAACTCTTAAGGG - Intergenic
951179835 3:19646441-19646463 GAGATTGGTGCCATTGATGATGG + Intergenic
952134121 3:30398105-30398127 GAGAATGATCCCTCTCTTAAAGG + Intergenic
958934186 3:100239648-100239670 GAGATTAGTGCCACCATCAAGGG + Intergenic
964769544 3:160210122-160210144 TGGATTGGTGACAGTCTTAAAGG - Intergenic
965104372 3:164339298-164339320 GAGTTAGGTGGCCCTCTTAAGGG - Intergenic
965492349 3:169354104-169354126 GAGATTAATTCCACTCTCAATGG - Intronic
970716157 4:18926779-18926801 GATTTTGGTGCCACTGTAAAAGG - Intergenic
971435407 4:26617218-26617240 GGGATTGGTGCCATTATAAAAGG - Intronic
976864314 4:89705862-89705884 GAGATCAGTGCCACCTTTAAAGG - Intergenic
979048114 4:115895565-115895587 AAGATTGGTGCCACCATTAATGG + Intergenic
980158647 4:129134792-129134814 GAGATTCATGCCCCTATTAAAGG - Intergenic
983004687 4:162469142-162469164 GAGATTGGTAACATTCTAAAGGG - Intergenic
983746753 4:171210337-171210359 CAGATTGATGCCACTCTTTTAGG - Intergenic
983870683 4:172821997-172822019 GAGATTGTTGCCACCCCTTACGG - Intronic
984462223 4:180052790-180052812 GGGATTGGTGCCATTATAAAAGG + Intergenic
988862426 5:35297300-35297322 TACATTGTTGCCAGTCTTAAAGG + Intergenic
990054579 5:51556237-51556259 GAGGTTTCTGCCACTATTAATGG + Intergenic
995066247 5:107866496-107866518 GATATGGCTGCCGCTCTTAACGG + Intronic
995556586 5:113336139-113336161 GGGATTGGTGCCATTTTAAAAGG - Intronic
1000240044 5:159400830-159400852 CATATTGATGCCACTATTAAAGG - Intergenic
1000965739 5:167653913-167653935 GAGAATGGAGCCAATCTAAAAGG + Intronic
1003155175 6:3587825-3587847 GAGATTAGTGCCCTTCTTAAAGG - Intergenic
1004367061 6:15021609-15021631 GAAATTTATGTCACTCTTAAAGG - Intergenic
1005930991 6:30483860-30483882 GAGACTGGTGCGACCCCTAATGG - Intergenic
1006566137 6:34959253-34959275 GAGATTGTTGCCATTCTTAATGG + Intronic
1013063553 6:106660861-106660883 GGGATTGGTGCCATTCTAAGAGG - Intronic
1018540639 6:164875786-164875808 GAGATTAGTGCCACCATCAAAGG + Intergenic
1018955269 6:168405555-168405577 GAGATTAGTGCCACCATCAAAGG - Intergenic
1026418239 7:70205329-70205351 TAGATTGGTGGGACTATTAAAGG - Intronic
1028901173 7:96101886-96101908 GAGATTGGTGCCACTCTTAAAGG + Intronic
1036582645 8:10089879-10089901 CGGATTGGTGCCATTCTCAAGGG - Intronic
1037702167 8:21285084-21285106 GAGATTGGTGCCATCCTTAAAGG + Intergenic
1040890554 8:52312460-52312482 GAGATTAATGCCATTCTTGATGG + Intronic
1044147151 8:88731114-88731136 CTGATGGGTGCCAATCTTAATGG + Intergenic
1047441965 8:124886542-124886564 GAGACTAGTGCTACCCTTAAAGG - Intergenic
1049134722 8:140885825-140885847 GAGATGGGTGAGACTCTCAAAGG + Intronic
1049549458 8:143250295-143250317 GAGATTGGAGCCGCAGTTAAAGG - Exonic
1049919411 9:349376-349398 GAGATTCATGCAACTATTAATGG + Intronic
1050056302 9:1659310-1659332 GAAAATGATGTCACTCTTAAAGG - Intergenic
1056848188 9:90058476-90058498 GACTTTGGAACCACTCTTAAAGG - Intergenic
1057380949 9:94567159-94567181 GAGGTTGGTGCCACTGTTTATGG - Intronic
1061172779 9:128970647-128970669 GAGAGTGAGGCCACTCTTTATGG + Intronic
1186977489 X:14923716-14923738 GAGATTGGTCTCACTCTTCATGG - Intergenic
1190713767 X:53087701-53087723 CAGATAGGTGTCACTCTAAAAGG - Intronic
1193261761 X:79415516-79415538 ATGATTGGTGCCACCCTGAAGGG - Intergenic
1195306503 X:103588119-103588141 GAGATGGGTGCCACTCTTCCTGG + Intergenic
1197084324 X:122454490-122454512 GAGATTAGTGCCACCATCAAGGG - Intergenic
1197554380 X:127936536-127936558 GAGATTAGTGCCACCATCAAGGG - Intergenic
1199581964 X:149369244-149369266 GAGATTGGTCCTGTTCTTAAAGG - Intergenic
1200345473 X:155442472-155442494 CACATTGGTGCCAGTGTTAATGG - Intergenic
1200925012 Y:8646536-8646558 GAGATTCCTGCCCCTTTTAAAGG - Intergenic