ID: 1028907694

View in Genome Browser
Species Human (GRCh38)
Location 7:96173498-96173520
Sequence ATAAGTGAACAAATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028907694 Original CRISPR ATAAGTGAACAAATGCAGCT GGG (reversed) Intronic
900812347 1:4816470-4816492 ATGAATGAACAAGGGCAGCTTGG - Intergenic
901689273 1:10961954-10961976 ATAAATGAACAAATGCTTGTTGG + Intronic
902427054 1:16331753-16331775 ATAAATAAATAAATGCAGCCAGG + Intronic
903018493 1:20377380-20377402 ATAAATGAATAAGTGCAACTTGG - Intergenic
906724525 1:48034412-48034434 ATAAGTGAATAAATGAAACCTGG + Intergenic
909143474 1:71896910-71896932 ATAAATGAAAAAATGAAGCTTGG + Intronic
912020767 1:105106915-105106937 AGAAATGAACAAAGACAGCTTGG + Intergenic
912358963 1:109078760-109078782 GTAAGTAAAAAAGTGCAGCTAGG + Intergenic
912467533 1:109884188-109884210 ATAGGTGACCAAATGCAGTGGGG + Intergenic
912580480 1:110716810-110716832 ACATGTAAACAAATGGAGCTTGG + Intergenic
913398350 1:118397939-118397961 ATCAGAGACCAAATGCATCTTGG + Intergenic
913440673 1:118893821-118893843 ATAAGTGAATAAACTCTGCTAGG - Intronic
915617738 1:157053380-157053402 ATAAGAAAAGAAAAGCAGCTGGG - Intergenic
915703476 1:157820591-157820613 ATAAGTCATCATATGCAGCAAGG - Intergenic
915799003 1:158768546-158768568 ACAAGTGAACAAATGCAAGTAGG - Intergenic
917300214 1:173565403-173565425 ATAAGTGAAAGAATGAAACTAGG - Intronic
917775404 1:178328925-178328947 ATCAGGGAACAAATATAGCTGGG - Intronic
918877976 1:190074676-190074698 AAAAGTGAGCAAAAGAAGCTAGG + Intergenic
921621762 1:217333288-217333310 GAAAGAGAACAAATGCAGCTGGG + Intergenic
1064811683 10:19207075-19207097 GTATGTGAATAAATGCAGCCAGG - Intronic
1065675305 10:28167380-28167402 ATAAGTGAGAACATGCAGTTTGG - Intronic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1067104444 10:43356720-43356742 AGGAATGAACAAAGGCAGCTTGG + Intergenic
1071296156 10:84221504-84221526 ATAGGTGAAAAACTGCAGCCTGG - Exonic
1072936985 10:99722852-99722874 ATAAGTAAATAAATGAAGTTTGG + Intronic
1073318017 10:102596564-102596586 ACAAGGGAACCAATGCATCTAGG + Intronic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1074143542 10:110697586-110697608 AGAAGTGAACTCATGCAGGTAGG - Intronic
1075567647 10:123516152-123516174 ATGAGTGAACAACTGGAGTTGGG + Intergenic
1076550417 10:131274353-131274375 AAAACTGAACAAGTGCAGCTGGG - Intronic
1077778664 11:5300684-5300706 ATAAGTGGACTAAAGCAGCTTGG - Intronic
1078193133 11:9109946-9109968 ATAAATAAATAAATGAAGCTAGG + Intronic
1079663819 11:23077763-23077785 ATAAGTTAACAATTACATCTTGG - Intergenic
1081365620 11:42231538-42231560 ACAAGTAAACATATGCAGCAGGG - Intergenic
1082030970 11:47603114-47603136 CTAAGTGGAGCAATGCAGCTAGG + Intergenic
1082274630 11:50208139-50208161 AGGAATGAACAAAGGCAGCTTGG - Intergenic
1082617115 11:55374261-55374283 ATATATGAACATATGCAGATTGG - Intergenic
1084010168 11:66343643-66343665 ATAAGAGAAGGAAAGCAGCTGGG + Intronic
1084727652 11:70952422-70952444 AGGAGGGAGCAAATGCAGCTGGG - Intronic
1084990308 11:72916608-72916630 AAAAGTGAACAAAGGAGGCTGGG - Intronic
1085441945 11:76572749-76572771 AAAAGTAAACAAATGGGGCTGGG - Intergenic
1087468493 11:98541594-98541616 ATAAGTAAACAAATACAAATAGG + Intergenic
1087689912 11:101308737-101308759 AAAAGTGAAAAAAGGAAGCTCGG - Intergenic
1090062212 11:123473820-123473842 ATAAGTAAACAAATGTGACTGGG - Intergenic
1091081771 11:132676944-132676966 ATATGTGAACAAAGACAGTTTGG - Intronic
1092044487 12:5420588-5420610 AAAAGTGAACAAATGCAGGCAGG - Intergenic
1092551791 12:9510181-9510203 ATATGTGAACATAGGAAGCTGGG + Intergenic
1093311431 12:17591365-17591387 TTTAGTGAACAAAAGAAGCTGGG - Intergenic
1094365386 12:29674435-29674457 ATGAGTAAAGGAATGCAGCTAGG + Intronic
1095404164 12:41849345-41849367 AGAAATGAACAAAAGCAACTGGG - Intergenic
1096355945 12:50941145-50941167 AAAAATGAAAAAATTCAGCTGGG - Intergenic
1098451873 12:70628251-70628273 ATAAATGAATAAATGCTGATTGG + Intronic
1098824538 12:75278179-75278201 ATAAAAGAACAAATACAACTGGG + Intronic
1099874128 12:88383346-88383368 ACAATTGAACAATTGCAGATGGG - Intergenic
1100086737 12:90920002-90920024 AAAATAGAGCAAATGCAGCTAGG - Intronic
1100966360 12:100017389-100017411 ATATGGGGACAAATGCAGATAGG - Intergenic
1101431795 12:104633081-104633103 ATAAATGCACGAAAGCAGCTGGG + Intronic
1101465871 12:104948920-104948942 ATAAATGAACAAATACGGCTGGG + Intronic
1101673629 12:106898534-106898556 GTGTGTCAACAAATGCAGCTGGG + Intergenic
1102267815 12:111503181-111503203 ATTTGTGAACAAATGCAGTTTGG + Intronic
1102698517 12:114818363-114818385 ATAAGTGAACAAATGCTAGCTGG - Intergenic
1103135060 12:118499756-118499778 AGAAATGAAAAAATTCAGCTGGG - Intergenic
1104435819 12:128755631-128755653 ATAAATGAACTGATGCTGCTGGG - Intergenic
1105779283 13:23692502-23692524 ATAAGTGAACAAATGAAATACGG + Intergenic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1106967738 13:35091890-35091912 ATTAATGAACATATTCAGCTAGG - Intronic
1107236433 13:38176183-38176205 AGGAATGAACAAAGGCAGCTTGG + Intergenic
1108842207 13:54632911-54632933 ATAAGTGAACAAAGGTTGCCAGG + Intergenic
1109224134 13:59672063-59672085 ATATGTGAATATATGCAACTTGG + Intronic
1110953925 13:81529401-81529423 AGGAATGAACAAAGGCAGCTTGG - Intergenic
1111529486 13:89518299-89518321 AGTAATGAACAAAGGCAGCTTGG + Intergenic
1111915484 13:94356012-94356034 ATAAGTGAGAAAATGCTGTTTGG + Intronic
1112194701 13:97213728-97213750 ATGAGTGAACAAGTGGATCTAGG + Intergenic
1112959001 13:105098555-105098577 AGAAGTAAATAAATGCAACTAGG + Intergenic
1114746348 14:25152355-25152377 ATAAGTGAAGAAAGGGAGATGGG - Intergenic
1115375743 14:32673437-32673459 ATAAATGGATGAATGCAGCTGGG + Intronic
1116345545 14:43788145-43788167 ATAAGTGAATAAGTGCACTTTGG + Intergenic
1116695274 14:48167358-48167380 ATTAGTGAACAATGACAGCTTGG - Intergenic
1117747932 14:58890622-58890644 AAAAGTGAACAAAAACGGCTGGG + Intergenic
1118051416 14:62032907-62032929 AAAAGTGAACCAATTCAGATGGG - Intronic
1119184152 14:72626370-72626392 ACAAGTGAGCAAATGCATGTAGG + Intronic
1122383553 14:101328266-101328288 ATATGTGAAAAAATGAACCTGGG - Intergenic
1124196305 15:27633346-27633368 ATAAATGTAAAAATGTAGCTAGG - Intergenic
1125070102 15:35544555-35544577 ATAAGTGAATAAGTGAAACTGGG - Intronic
1126111212 15:45175759-45175781 AGAAGGAAACAAATGGAGCTTGG - Intronic
1129188613 15:73925117-73925139 ATGGGTGAACAAATGCTGCCTGG + Intergenic
1131552259 15:93367119-93367141 AGAAGTGAATAAATTGAGCTTGG + Intergenic
1133005885 16:2881809-2881831 ATAAATGCACAAAGGTAGCTGGG + Intergenic
1133524366 16:6589804-6589826 ATAAATGAACAAGGACAGCTTGG + Intronic
1133707740 16:8371265-8371287 AAAATTAAACAAATGCAGGTGGG - Intergenic
1136503903 16:30690220-30690242 TTAAGAGCACAAATGTAGCTGGG + Intergenic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1137045474 16:35654246-35654268 ATAAGTGAAGAAATGTCCCTTGG - Intergenic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1143503275 17:7351082-7351104 ATAACGGAATGAATGCAGCTGGG - Intronic
1149317622 17:55453330-55453352 AAAAGTGAACCCATGCAGTTAGG + Intergenic
1149348200 17:55760134-55760156 ATAAGTGAAGAAATGGAGGCTGG - Intronic
1149675450 17:58456961-58456983 AAAAATGAAAAAAGGCAGCTGGG + Intronic
1149770555 17:59317545-59317567 GGAATTGAACAAATCCAGCTAGG - Intergenic
1150634121 17:66900797-66900819 ATAAGTGAACCAACGCAAGTCGG - Intergenic
1150973630 17:70058948-70058970 GTTAATGAACAAATGAAGCTGGG + Intronic
1154252086 18:12753126-12753148 ATAAGTGTACTAAGCCAGCTCGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156846726 18:41674300-41674322 ATCAGAGAACAAAGTCAGCTGGG - Intergenic
1157686622 18:49647805-49647827 ATAAATGAACACCTGAAGCTGGG - Intergenic
1158559398 18:58500939-58500961 CTAAATGAGCAAATGCAGCCAGG + Intronic
1159124032 18:64202191-64202213 ATAAGTGAAGAAATACACCAGGG + Intergenic
1163565373 19:18048093-18048115 AAAATTGAAAAAATGTAGCTGGG - Intergenic
1164541750 19:29126710-29126732 AGCAGTGAACATATTCAGCTGGG + Intergenic
1166577569 19:43856953-43856975 ATGAGTGAAAACATGCAGCATGG + Intergenic
1167635639 19:50653645-50653667 ATAAGTCAACACATTCAACTTGG - Intronic
1167839139 19:52099595-52099617 AGGAGTGGACAAAGGCAGCTTGG - Intergenic
926095994 2:10080647-10080669 ATAAATGAACAAACTCAGCCGGG - Intronic
926937246 2:18098389-18098411 ATGATGGAACAAATGCAGATGGG - Intronic
927968228 2:27285658-27285680 GTAAGTGAACAAAGGCAGGTGGG - Intronic
930118547 2:47740852-47740874 AAAAATGAAAAAATTCAGCTGGG - Intronic
933858988 2:86445410-86445432 TTATGTGAACAAAATCAGCTAGG - Intronic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
934726313 2:96622126-96622148 AAAATTAAACAAATGCAGCCAGG + Intronic
935087455 2:99862041-99862063 ATCAGTGAAGAAAAGCAGTTTGG - Intronic
935511947 2:103986734-103986756 ATGAATGAACAAATGAAACTAGG - Intergenic
935895548 2:107733716-107733738 ATAAGAGCACTAATCCAGCTGGG - Intergenic
937630003 2:124090998-124091020 AGAAGTGAAGAAATCCACCTGGG + Intronic
937789844 2:125946740-125946762 ATTAGTGAGCAAATGCATTTTGG + Intergenic
939518054 2:143193528-143193550 ATAAGTGAAGAAAGGAAACTGGG + Intronic
939982582 2:148798920-148798942 ATAAGTGAATGAATGGTGCTAGG + Intergenic
941115600 2:161468450-161468472 ATAAGTGAACAAAAGTAATTAGG - Intronic
941306900 2:163881070-163881092 ATAACTACACAATTGCAGCTGGG - Intergenic
941932956 2:170960568-170960590 TTAAGAAAACAAAAGCAGCTTGG - Intronic
945459292 2:210086089-210086111 ATAATTGAAAAACTGCAGTTAGG - Intronic
946373209 2:219293157-219293179 ATAAATAAATAAATGCAGTTTGG - Intronic
947710556 2:232311812-232311834 TTGACTGAACAAATGCAGATTGG - Intronic
1172684444 20:36743512-36743534 ATAATAAAACAAAAGCAGCTCGG + Intronic
1173297380 20:41771774-41771796 ATAAATGAACAAAACCATCTTGG + Intergenic
1173584910 20:44175270-44175292 ATAAGTGAACAAAAGCCATTTGG - Intronic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1173874385 20:46360842-46360864 AAAAATCAACAAATGCAGCCGGG - Intronic
1175351433 20:58323330-58323352 ATTAGTGAATAAATTCAGCAAGG - Intronic
1175428058 20:58882664-58882686 ATAGGTGAACAGTAGCAGCTTGG - Intronic
1176699891 21:10033404-10033426 ATAAGTTAAAAAATTTAGCTGGG + Intergenic
1177483655 21:21726839-21726861 GTAACTGATAAAATGCAGCTGGG + Intergenic
1177801410 21:25832367-25832389 ATGAGTGAACAACGACAGCTAGG - Intergenic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1185093252 22:48788849-48788871 ATAAGTGAGAAAATGTGGCTGGG - Intronic
949911120 3:8908770-8908792 ATAAGTGAAAAAATAAAGCAAGG - Intronic
950115440 3:10447703-10447725 ATAAGTGAGCACAAGAAGCTGGG + Intronic
950151875 3:10693821-10693843 TTAGGTGAACAAATACATCTAGG + Intronic
950780657 3:15388867-15388889 AGGAATGAACAAATACAGCTCGG + Intronic
950826537 3:15828747-15828769 GTCAGTGAACAAGTGCAGCGTGG - Intronic
954009765 3:47625589-47625611 GTAGGTCAACAAATGGAGCTGGG + Intronic
954238360 3:49274489-49274511 ATAAGTAAACAAATGCAGGCTGG - Intronic
958655222 3:96992793-96992815 AAAAGGGTACAAAAGCAGCTAGG - Intronic
960097909 3:113705714-113705736 ATAAGTGAAAAAATAAAGCCTGG - Intergenic
962201909 3:133407084-133407106 ATAAATAAATAAATGCTGCTGGG + Intronic
963637940 3:147823011-147823033 ATAATTGAACAAAAGAAGATTGG - Intergenic
965733513 3:171797239-171797261 ATGAGTGAACAACTACAGATCGG - Intronic
966533931 3:181009873-181009895 AGAAATGAACAAAGACAGCTTGG + Intergenic
966811318 3:183847402-183847424 AAAAATGAACAAAATCAGCTGGG + Intronic
966949334 3:184802128-184802150 ATAACTGAAACAAAGCAGCTGGG - Intergenic
967278017 3:187795493-187795515 AAAAGAGAACAAAATCAGCTAGG + Intergenic
967310749 3:188103852-188103874 TTAAAACAACAAATGCAGCTGGG - Intergenic
967928491 3:194672348-194672370 ATAAGTGAAAAAATGGTTCTGGG + Exonic
970279131 4:14434862-14434884 AATATTGAATAAATGCAGCTAGG - Intergenic
971613220 4:28753523-28753545 ATCAGTGAACAAATGGAGGATGG - Intergenic
972370831 4:38421787-38421809 ATAAAAGAACACATGAAGCTGGG + Intergenic
973973703 4:56241418-56241440 ATGAGTGAATAAAAGCAACTAGG + Intronic
974415873 4:61606205-61606227 TGAAGTGAACTAATGCAGTTTGG + Intronic
974433435 4:61828105-61828127 ATAAGTGAATAAATGAAGCCAGG + Intronic
974923183 4:68267446-68267468 AAGAATGAACAAAGGCAGCTTGG - Intergenic
975054152 4:69907012-69907034 AAAAGAGAAAAAATCCAGCTAGG - Intergenic
975204699 4:71631327-71631349 AGGAGTGACCAAATACAGCTTGG + Intergenic
975414961 4:74095324-74095346 ATAAGTAAATAAATGCAGCCGGG - Intergenic
977226607 4:94399338-94399360 ATAGGTGAACAAATTCAGACAGG + Intergenic
978456811 4:108902445-108902467 ATAAGTGAACGAATGTATCTAGG + Intronic
978469650 4:109049982-109050004 ATAAATAAACAAATACAACTAGG + Intronic
980372299 4:131892020-131892042 ATAAGTTAAAAAATTTAGCTGGG + Intergenic
981561895 4:146056996-146057018 ATAAATGAATAAAGGCAACTTGG + Intergenic
982663616 4:158233997-158234019 ATAATAAAATAAATGCAGCTTGG + Intronic
984001672 4:174253653-174253675 ATAATTCAACAACTGCAGCTAGG - Intronic
984310114 4:178047079-178047101 AGGAATGAACAAAGGCAGCTTGG + Intergenic
984872929 4:184343299-184343321 GTAAGCCCACAAATGCAGCTGGG + Intergenic
985927218 5:3027719-3027741 ACAACTGAGCATATGCAGCTTGG + Intergenic
987266483 5:16261472-16261494 ATAAGTGAAGAAATGAATCAAGG + Intergenic
987285201 5:16449206-16449228 AGAAGTGAACACATGCATGTGGG - Intergenic
988237748 5:28568240-28568262 ATAAATGAACCAAAGCAGCATGG + Intergenic
991239863 5:64445314-64445336 AGGAGTGAACAAGGGCAGCTTGG - Intergenic
991627461 5:68618793-68618815 ATAATTGAACGGATGCAGATAGG - Intergenic
993393573 5:87354028-87354050 ATCACTGTACAATTGCAGCTGGG - Intronic
993421996 5:87714284-87714306 AGAAATGAACAAAGACAGCTTGG + Intergenic
994914703 5:105959574-105959596 ATAAGAGAAGAAATGCAGAAAGG + Intergenic
995430493 5:112069712-112069734 ATAAGGGACTAAATGCATCTTGG - Intergenic
996525383 5:124473766-124473788 ATTACTGGACAAAGGCAGCTGGG + Intergenic
997563853 5:134872221-134872243 ATAACTGAGCAATTGCACCTGGG + Intergenic
998632298 5:143912600-143912622 AAAAGAAAACAAAAGCAGCTAGG + Intergenic
999178100 5:149646372-149646394 AGAAGTGAGCAAATGGTGCTGGG - Intergenic
1000876683 5:166647949-166647971 CTAAATGAACCAATACAGCTAGG + Intergenic
1001165645 5:169363608-169363630 ATAAGTGAACAACTGTACTTTGG - Intergenic
1003040102 6:2680182-2680204 ATAGGTGTACGAATGGAGCTGGG - Intronic
1003172029 6:3727413-3727435 ATCAGTGTCCAAATGCAGGTAGG + Intronic
1003223561 6:4184295-4184317 AGAAATGAAAAAATGCAGGTAGG - Intergenic
1006220884 6:32490225-32490247 ATCAGGGAAGAAATGTAGCTAGG - Intergenic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1007460144 6:42012017-42012039 AAAAATGAGCTAATGCAGCTGGG - Intronic
1008260807 6:49364874-49364896 ATAACTGATAAAATTCAGCTTGG - Intergenic
1009600476 6:65791173-65791195 ATAAATGAATAAAGGCACCTTGG + Intergenic
1010965850 6:82207217-82207239 ATTAGTGAACAAGTTCAGCAAGG + Intronic
1011772935 6:90694978-90695000 TTAAGTGCAGAAACGCAGCTAGG + Intergenic
1013460039 6:110365998-110366020 ATAAGAGGAGAAATGAAGCTGGG + Intergenic
1014638215 6:123875834-123875856 ATTAGTCAACAAATGAAGGTAGG - Intronic
1014832537 6:126119976-126119998 AAAAGTGACCAAATAAAGCTTGG + Intergenic
1015847101 6:137532124-137532146 AGAAATGAACAAGGGCAGCTTGG + Intergenic
1016430946 6:143984899-143984921 ATAAGGAAACAAATGCCCCTAGG + Intronic
1017752993 6:157505915-157505937 AACACTGAACAAATGCAGCTCGG + Intronic
1017953552 6:159159365-159159387 AGATTTGAATAAATGCAGCTGGG + Intergenic
1018545975 6:164936147-164936169 TTAAGTGAGCAAATGCATGTGGG - Intergenic
1020936326 7:14469213-14469235 ATAAATGAAGAAATGGAACTTGG - Intronic
1022061677 7:26802877-26802899 ATAAATAAATAAATGCTGCTTGG + Intronic
1023502995 7:40870766-40870788 ATAAGTAAACAAATGGAGAACGG - Intergenic
1025059954 7:55797671-55797693 AAAAATGAAAGAATGCAGCTGGG + Intronic
1025215709 7:57054293-57054315 AAGAATGAACAAAGGCAGCTTGG - Intergenic
1026190226 7:68118953-68118975 AGGATTGAACAAAAGCAGCTTGG - Intergenic
1027234777 7:76291818-76291840 GTAAGGGAAAAAATGCAGCCAGG + Intergenic
1028250380 7:88533140-88533162 ACAAGAGAACAAAATCAGCTAGG - Intergenic
1028907694 7:96173498-96173520 ATAAGTGAACAAATGCAGCTGGG - Intronic
1030965416 7:115987482-115987504 ATAAGTGAACAAATGAACAATGG - Intronic
1031731401 7:125306396-125306418 AGAGGTGAACAATTTCAGCTTGG + Intergenic
1033272001 7:139940332-139940354 CTTAGAGAACAAAGGCAGCTGGG - Intronic
1033718774 7:144034314-144034336 ATAAGAAAACAAATGTGGCTGGG + Intergenic
1035028024 7:155838915-155838937 ATAAGTGAACACATGAAGTGTGG + Intergenic
1037692337 8:21192749-21192771 ATAAATGAACCAACACAGCTTGG + Intergenic
1038090390 8:24246875-24246897 AGGAATGAACAAGTGCAGCTTGG - Intergenic
1038774190 8:30513245-30513267 ATAAAGAAACAAATTCAGCTGGG - Intronic
1039336777 8:36600059-36600081 AAAAGTGAATAAATCCAGATTGG - Intergenic
1039824656 8:41162779-41162801 ATAAATGAACAAATGAGGCCGGG - Intergenic
1041176800 8:55205447-55205469 ATAAATGAACAAATGTACTTAGG + Intronic
1041242952 8:55863869-55863891 AAAAGTAAACAAAAACAGCTGGG + Intergenic
1041451212 8:58008426-58008448 ACAATTGAAAAAATGCAGCCAGG - Intronic
1041504277 8:58577170-58577192 ATAAATGAACAAATGCCCTTTGG - Intronic
1042154192 8:65824131-65824153 AGAAGTGAGCAGATGCAGTTGGG - Intronic
1043220142 8:77651774-77651796 ATTAGTGAACCATTGCACCTAGG + Intergenic
1045355456 8:101384590-101384612 TTAAGTGAGCACATGCTGCTGGG + Intergenic
1046490634 8:114948598-114948620 ATAAGTGCTTAAATGAAGCTTGG + Intergenic
1051433164 9:17001585-17001607 CTAAGAGCAGAAATGCAGCTAGG + Intergenic
1051856459 9:21572827-21572849 ATAAGTCAACATATTCTGCTTGG + Intergenic
1052611633 9:30783349-30783371 AGAAGTGAATTAATGCAGCTTGG + Intergenic
1052782981 9:32799788-32799810 ATAAGTGAACAAATAAAGGGAGG - Intergenic
1053637033 9:40019870-40019892 ATAAGTTAAAAAATTTAGCTGGG + Intergenic
1053769000 9:41445048-41445070 ATAAGTTAAAAAATTTAGCTGGG - Intergenic
1054317861 9:63616715-63616737 ATAAGTTAAAAAATTTAGCTGGG + Intergenic
1054547667 9:66356528-66356550 ATAAGTTAAAAAATTTAGCTGGG - Intergenic
1056347269 9:85710102-85710124 ATATCTGAACAAATGCAGTATGG - Intronic
1056808631 9:89747109-89747131 AGAAGTGGACCAATGCAGGTGGG - Intergenic
1057108485 9:92444678-92444700 AATAGTGAACAAATGGTGCTGGG - Intronic
1058005514 9:99909935-99909957 AAAAAAGAAGAAATGCAGCTGGG + Intronic
1058634019 9:107019102-107019124 CTAAGTAAAAATATGCAGCTTGG + Intergenic
1058909965 9:109511971-109511993 ATAAATGAACAAATGGATCTTGG + Intergenic
1059363025 9:113761998-113762020 ATAATTTAACAAATGGTGCTAGG + Intergenic
1059780160 9:117517847-117517869 TTAAGTGAACAAGTAGAGCTTGG + Intergenic
1060035106 9:120248594-120248616 GTAAGTGAACAAATGAATCCTGG + Intergenic
1060850418 9:126870629-126870651 ATAATTAAACAAATGCAGCCGGG + Intronic
1062436737 9:136549703-136549725 ATAAGTGGAGAAAGGCAGATGGG - Intergenic
1202784902 9_KI270719v1_random:3463-3485 ATAAGTTAAAAAATTTAGCTGGG + Intergenic
1185731853 X:2467997-2468019 AAAGGTGCACAAATGCAGCCAGG + Intronic
1185745470 X:2569274-2569296 ATAAATGGAAAAATGCAGCCAGG - Intergenic
1188016722 X:25114481-25114503 ATAAATAAACAAATGCAGCCGGG - Intergenic
1189952431 X:46246397-46246419 ATAAGTAAACAAGAGCGGCTTGG + Intergenic
1192552809 X:72067565-72067587 ATAAGTGAATAACTGAAGCTTGG - Intergenic
1192637316 X:72832026-72832048 ATGGTTGACCAAATGCAGCTGGG + Intronic
1192644398 X:72888788-72888810 ATGGTTGACCAAATGCAGCTGGG - Intronic
1193558645 X:82989197-82989219 ATAAGTGAAAAAATATAACTGGG - Intergenic
1193606834 X:83579412-83579434 ATAAATGAACACCTGAAGCTGGG - Intergenic
1194620916 X:96170360-96170382 ATAAATGAATAAATTCAGCTAGG - Intergenic
1194709673 X:97220100-97220122 ATTATATAACAAATGCAGCTTGG - Intronic
1198272612 X:135068610-135068632 ATAAGTGACCAGATACAGCTGGG - Intergenic
1198644615 X:138792616-138792638 TTCAGTGAACAAATGGACCTAGG + Intronic
1198764506 X:140066880-140066902 AAAAATGAAAAAATACAGCTGGG - Intergenic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic