ID: 1028909523

View in Genome Browser
Species Human (GRCh38)
Location 7:96192440-96192462
Sequence GATTCTGGTGCTCCACGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028909520_1028909523 23 Left 1028909520 7:96192394-96192416 CCTAGAAGAGATCTCAGAATCTG 0: 1
1: 0
2: 0
3: 14
4: 245
Right 1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028909523 Original CRISPR GATTCTGGTGCTCCACGAGC AGG Intronic
904674160 1:32187950-32187972 AATTCCGGTGCTCCTCCAGCTGG - Exonic
904850259 1:33454053-33454075 CACTCTGGTGCTCCACGTGGTGG - Intergenic
912372852 1:109187204-109187226 GAATGTGCTGCTCCAAGAGCTGG + Intronic
913160406 1:116139999-116140021 GAGGCTGGTGGTCCAAGAGCAGG - Intergenic
913531155 1:119735250-119735272 GATCCTGGTGCTGCCCCAGCAGG + Intronic
915908425 1:159896811-159896833 AATTCTTGTGCTCCAGGAGTTGG - Intronic
918431921 1:184469902-184469924 GATGCTGGTCCTCCAAGGGCAGG + Intronic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
1064148398 10:12843157-12843179 GGTTCTGATGCTCCACGGGGAGG + Intergenic
1073441340 10:103554524-103554546 GATTCTGGTGCTGCACTGCCTGG + Intronic
1074087795 10:110221841-110221863 GACTCAGGTGCTGCCCGAGCTGG - Intronic
1075334154 10:121597139-121597161 GAGGCTGGTGGTCCCCGAGCGGG + Intronic
1077053699 11:579597-579619 GATTCAGGTGCGGGACGAGCAGG + Intronic
1077316727 11:1922641-1922663 GAGTCTGGGGCGCCAAGAGCTGG + Intronic
1085713306 11:78849973-78849995 GATTCTGGATCTCCACCTGCAGG + Intronic
1091940470 12:4475881-4475903 GATTCTGGTGCTTGACTATCTGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1098226686 12:68332077-68332099 GATTCTGGGGCCCCTCGAGCAGG + Intronic
1101993824 12:109510393-109510415 GCTTATGGTGCTGTACGAGCGGG + Exonic
1105008530 12:132738423-132738445 GACTCTGGGTCTCCAGGAGCTGG - Intronic
1105565540 13:21543693-21543715 AATTCTTCTGATCCACGAGCCGG - Intronic
1110646142 13:77886852-77886874 GAATCTGGAGCTCCAGGAGAGGG + Intergenic
1110677844 13:78271171-78271193 GAATCTGGTGCTTCAGGGGCTGG + Intergenic
1122746656 14:103901084-103901106 GATGCTGGTGCTCCAAGCCCAGG - Intergenic
1124200111 15:27672125-27672147 GATTCCGGTGCACCCCGAGTGGG + Intergenic
1126896059 15:53258315-53258337 GTTTCTGAGGCTCCACGTGCAGG + Intergenic
1128323667 15:66709280-66709302 GTTTGTAGTGCTCCACTAGCTGG + Intronic
1132952134 16:2569077-2569099 GATTCAGGGGATCCACGTGCAGG + Intronic
1132962216 16:2631093-2631115 GATTCAGGGGATCCACGTGCAGG - Intergenic
1142219637 16:88847597-88847619 GGCCCTGGTGCTCCAAGAGCCGG + Intronic
1146125132 17:30225342-30225364 GAGTCTGGGGCTCCACAGGCAGG - Intronic
1147805699 17:43129367-43129389 TATTCTGGAGCTCCTCCAGCTGG - Intergenic
1148356268 17:46977999-46978021 GATCCTGGGGCTCCACGCGGAGG - Intronic
1148825199 17:50387984-50388006 GATTCTCATGCTTCAGGAGCTGG - Intronic
1148839854 17:50488059-50488081 GATTCTGGGGCTCCACCTCCGGG - Intergenic
1153145316 18:2025029-2025051 GTTTCTGGTACTTCACGAGTGGG + Intergenic
1158381342 18:56933246-56933268 GATTCTGCTGCCCAAAGAGCTGG - Intronic
1158570839 18:58595890-58595912 GATGCTGGTGGTCCAAGACCAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163127092 19:15250184-15250206 GATTCTGGGGCTTCATGGGCGGG - Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1168130970 19:54318283-54318305 GATTCAGGCGCTACACGCGCAGG - Intergenic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
933136835 2:78747389-78747411 GATTCAGGAGGTCCACGTGCAGG + Intergenic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
937480229 2:122250817-122250839 GATTCTGGGGTTCTACAAGCAGG + Intergenic
942268626 2:174251532-174251554 GATTCTAGTACTCCATGACCGGG - Intergenic
944211597 2:197211661-197211683 GATTCTTGTGCCCCTCGAGGTGG - Intronic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
945952359 2:216051522-216051544 CATTCTGGAGCTGCAAGAGCAGG - Exonic
945992054 2:216404341-216404363 GCTTATGGTGCTCCACTTGCTGG + Intergenic
948614006 2:239186727-239186749 TCTTCTGGTGCCCCAGGAGCTGG - Intronic
1174479757 20:50822739-50822761 GATTCTCGTGCCCCAGCAGCTGG + Intronic
1175733463 20:61370006-61370028 TATTCTGGTGTTCCAGGACCTGG + Intronic
1176021274 20:62963537-62963559 GACTCTGGTGCCGCACGAGCTGG - Intronic
1179924040 21:44522621-44522643 CATTGTGTAGCTCCACGAGCCGG - Intronic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180286740 22:10752819-10752841 TATTCTTGTGCTGCAGGAGCCGG - Intergenic
1180551240 22:16543663-16543685 GGTTTTGGTGCTCCTCAAGCAGG - Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
961105113 3:124234204-124234226 GATTCATGTGCTCCTCTAGCAGG + Intronic
962883453 3:139600836-139600858 GATTCTAATGCTCCAAAAGCAGG - Intronic
969090375 4:4689618-4689640 GAGTCTGGTGCTCCAGGGGGAGG - Intergenic
972928450 4:44040901-44040923 GATTCAGGGACTCCAAGAGCTGG - Intergenic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
988404593 5:30807708-30807730 GATTCTGGTCCTCCAAAAGCAGG + Intergenic
996538364 5:124602249-124602271 AATTCTGGTCCTCCAGGAGCTGG + Intergenic
998870649 5:146548367-146548389 GATTCTACTGCACCACGAGCAGG - Intergenic
1000464235 5:161555401-161555423 CATTCTGCTGCTTCACCAGCAGG - Intronic
1000776165 5:165422865-165422887 GATGCTGGTGGTCCATGTGCTGG + Intergenic
1001245219 5:170101055-170101077 GATGCTGGTGGTTCACCAGCTGG - Intergenic
1002814527 6:667604-667626 CATTCTGGTGATTCAAGAGCAGG - Intronic
1010713169 6:79198808-79198830 GATTCTGGTGCAGCAAGAGTGGG - Intergenic
1013096616 6:106951403-106951425 GATTCTTGTGCTTCAGTAGCTGG + Intergenic
1017961878 6:159230509-159230531 GATTCAGGGGCTGCACGTGCAGG - Intronic
1019121891 6:169810702-169810724 GTGTCTGGTGCTCCACCCGCGGG - Intergenic
1023638618 7:42237247-42237269 GATGCCGGAGCTGCACGAGCGGG - Intronic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1034937985 7:155211995-155212017 GAGGCTGGTGCTGCAGGAGCTGG - Intergenic
1035023082 7:155810050-155810072 GGCTCTGCTGCTCCACGCGCGGG - Intronic
1037949057 8:23007049-23007071 CATCCTGGTGCTGCAGGAGCGGG + Exonic
1038017944 8:23530374-23530396 GATGCTGGTCCTGCATGAGCAGG + Intronic
1038462577 8:27729387-27729409 CATTCTGGTGCTGCAGGGGCAGG - Intergenic
1046234921 8:111411208-111411230 GATTCTGGTGGTACATGTGCAGG + Intergenic
1046366984 8:113246974-113246996 ACTTCTGGTCCTCCACCAGCAGG - Intronic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1049100934 8:140578479-140578501 GATTCAGGGACTCCGCGAGCAGG - Intronic
1193342159 X:80361853-80361875 GATTCAGGTGCTGCATGTGCAGG + Intronic
1195069283 X:101263748-101263770 GTTTCTGGTGCTCCAGGAAATGG + Exonic
1195942011 X:110174687-110174709 GGTTCAGGTGCTCCACAAGGAGG + Exonic
1199848472 X:151708515-151708537 GAGCATGGTGCTCCACAAGCTGG + Intergenic