ID: 1028910169

View in Genome Browser
Species Human (GRCh38)
Location 7:96199083-96199105
Sequence GGATTCAAAGAGATGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028910169_1028910172 -5 Left 1028910169 7:96199083-96199105 CCCTGCTTCATCTCTTTGAATCC 0: 1
1: 0
2: 1
3: 33
4: 312
Right 1028910172 7:96199101-96199123 AATCCTCTCCACAACCGAGGTGG No data
1028910169_1028910178 24 Left 1028910169 7:96199083-96199105 CCCTGCTTCATCTCTTTGAATCC 0: 1
1: 0
2: 1
3: 33
4: 312
Right 1028910178 7:96199130-96199152 CATCACCTCTGTTCTGAAGATGG No data
1028910169_1028910171 -8 Left 1028910169 7:96199083-96199105 CCCTGCTTCATCTCTTTGAATCC 0: 1
1: 0
2: 1
3: 33
4: 312
Right 1028910171 7:96199098-96199120 TTGAATCCTCTCCACAACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028910169 Original CRISPR GGATTCAAAGAGATGAAGCA GGG (reversed) Intronic
901705831 1:11072391-11072413 GGATTGAATGAGATGATGGATGG - Intronic
903731930 1:25503096-25503118 GGCTCCAGAGGGATGAAGCATGG - Intergenic
903896230 1:26607075-26607097 GGAGTGGAAGAGCTGAAGCAGGG + Intergenic
904200828 1:28818066-28818088 GGACTCAAAGAGATCGAGCATGG + Intronic
904486057 1:30825087-30825109 GGATTAAAATAGAGGGAGCACGG + Intergenic
904603556 1:31686475-31686497 GGATTCCATGAGGTGAAGCTGGG - Intronic
907410403 1:54279573-54279595 GGAGGCACACAGATGAAGCATGG + Intronic
907846641 1:58214428-58214450 AGATTCAAAAAGATAAACCAGGG + Intronic
907953146 1:59203317-59203339 GGATTCAAAGAGATGAAGGGAGG + Intergenic
908115816 1:60938949-60938971 GGACTCAAGGAGATAAGGCATGG + Intronic
908545390 1:65157397-65157419 GGATGCAAAGAGGTGAAACAAGG + Intronic
908631951 1:66118982-66119004 GTATACATAGAGATGAAGAAGGG - Intronic
909422819 1:75485331-75485353 GAATTCAAAGAGATGACTTAGGG - Intronic
909884488 1:80923881-80923903 GCATTCAAAAAAATGAAGTAAGG - Intergenic
911198393 1:95018770-95018792 GACTTCACAGAGATGAATCATGG + Intronic
912148215 1:106820792-106820814 GGATTCTAAGAGATGAGACTGGG - Intergenic
912338824 1:108889716-108889738 GGGTTCCAAGAGGTGAAGAATGG - Intronic
912370200 1:109167902-109167924 GGATTTAAGGAGATGAGGCTGGG - Intronic
912603235 1:110960760-110960782 GGATTCAAAGAAATATAGAAGGG - Intronic
916813051 1:168322630-168322652 GGAGCCAAAGAGAGGAAGCCTGG + Intergenic
917182207 1:172311072-172311094 GGATTGAATGAGATAATGCAGGG + Intronic
918236250 1:182583234-182583256 AGATTCAAAGAGATACAGTAAGG + Intronic
918878328 1:190080830-190080852 TGATTCTAACAGATGCAGCAGGG + Intergenic
918963544 1:191310123-191310145 TGATGCAAAGAAATGAAGCATGG + Intergenic
919757269 1:201073933-201073955 AGATTCATAGAGTGGAAGCATGG + Intronic
919976885 1:202618654-202618676 GGATTAAATGAGATGTTGCATGG + Intronic
920867453 1:209764901-209764923 GGATTTACAGACATGATGCACGG - Intronic
921689670 1:218133661-218133683 GAAGTCAAATAGATGAAGCTGGG + Intergenic
922476592 1:225911021-225911043 GGATTCAATGAGATAAAGGCTGG - Intronic
923261548 1:232272656-232272678 GAATCTAAAGAGATGAAGCCAGG - Intergenic
923533463 1:234829936-234829958 GCATTCAAGGAGATGAATAAAGG + Intergenic
923767085 1:236902177-236902199 GGCTTCCAAGACATGAGGCAGGG - Exonic
923963590 1:239110245-239110267 GGAGTCAAGGAGATGAACAATGG + Intergenic
1062896350 10:1106207-1106229 AGATTAAAAGAGAAGAACCAGGG - Intronic
1063853026 10:10214638-10214660 AGATTAAAAGGGAGGAAGCATGG - Intergenic
1063893983 10:10659828-10659850 GGCTTCAAAGAGACTTAGCAGGG + Intergenic
1064127934 10:12680558-12680580 GGATTCAAAGAGATGAGATCCGG - Intronic
1064804502 10:19115185-19115207 GGTTTCTAGGAGAAGAAGCAGGG - Intronic
1065762015 10:28991290-28991312 GGATTAAAGGAGATAAAGTATGG + Intergenic
1066432436 10:35364100-35364122 GGTGTCAAAGAGATGATGGAAGG + Intronic
1066528393 10:36307854-36307876 GGTTCAAAAGAGATCAAGCAAGG + Intergenic
1067330287 10:45309369-45309391 GGATGAAATGAGATCAAGCAGGG - Intronic
1068024847 10:51629874-51629896 GGTTTGAAAGAGATGGAGCCAGG - Intronic
1068516777 10:58035093-58035115 GGATCCAAAGAGATAAAGAAGGG - Intergenic
1069981389 10:72255236-72255258 GGAAACAAACAGATGAAGGAGGG - Intergenic
1070351486 10:75597043-75597065 GGACTCAAAGAGAGAAAGCAAGG - Intronic
1072537938 10:96377493-96377515 GGACTAAAAGAGAGGATGCATGG - Intronic
1072745627 10:97937285-97937307 GGTTTAAAGGAGATGAAGGAGGG - Intronic
1073906184 10:108282724-108282746 GGAGACAAAGATATGAAGGATGG + Intergenic
1073963830 10:108965271-108965293 GGATTCACAGATATAAAGCCTGG - Intergenic
1074303925 10:112258486-112258508 GGATTCAATGAGATAATGCATGG + Intergenic
1075338778 10:121628924-121628946 GTATTAGAAGAGATCAAGCAAGG + Intergenic
1075472334 10:122700804-122700826 GGAGTCAAAAAGATCAAGGAAGG + Intergenic
1075845274 10:125540265-125540287 GGACTGAAAAAGATGAAGCGTGG - Intergenic
1076212759 10:128662113-128662135 GGAATTAAAGAGAAGAAGGAGGG - Intergenic
1076473779 10:130738456-130738478 AGAGTCAAAGAGAGGTAGCAAGG + Intergenic
1076638549 10:131899305-131899327 GGACCCAAAGAGGGGAAGCAGGG - Intergenic
1078080586 11:8201884-8201906 GTTTTCAAGGAAATGAAGCAAGG + Intergenic
1078525693 11:12099408-12099430 GGATGCAGAGAGAAAAAGCATGG + Intronic
1078705204 11:13737216-13737238 GTTTTCAAAGAGATGAAGCTAGG - Intergenic
1078970761 11:16408647-16408669 GGATGAAATGAGATGAAACATGG + Intronic
1079106982 11:17578091-17578113 GGATTCAATATGATGATGCAGGG + Intronic
1079420109 11:20277928-20277950 GGATTAAATGAAATAAAGCATGG - Intergenic
1079454664 11:20626079-20626101 GGATTCAATGAGCTAATGCATGG - Intronic
1084131126 11:67135521-67135543 GGATCTAAAGAGATGAATTAAGG - Intronic
1085103530 11:73822116-73822138 AGATTCAGAGAGATGAAACTGGG + Intronic
1085109591 11:73875968-73875990 GGAAGCACAGAGATGAAGCCGGG + Intronic
1085262119 11:75212243-75212265 AGATTGAATGAGATGATGCAAGG - Intergenic
1085677744 11:78540627-78540649 GAATACATAAAGATGAAGCATGG + Intronic
1085928583 11:81053673-81053695 GGATTCAAACAGCAGCAGCATGG - Intergenic
1086518264 11:87639905-87639927 GAATTCATAGAGATGATACAGGG - Intergenic
1088668181 11:112115614-112115636 TGATTCAAAGGCAGGAAGCAGGG + Intronic
1089071388 11:115702066-115702088 GGATTCCCAGAGACTAAGCAGGG - Intergenic
1089873836 11:121701088-121701110 GCCTTGAAAGAGATAAAGCATGG - Intergenic
1090550469 11:127814110-127814132 GAAATAAAAGAGATGAAGCCAGG + Intergenic
1090683958 11:129094909-129094931 GTATTAAATGAGATGATGCATGG + Intronic
1091642367 12:2247063-2247085 GGAGTCAAAGGGAAGAAGGAAGG - Intronic
1091844791 12:3647431-3647453 AGATTCAAAGAGAATGAGCAGGG - Intronic
1092859954 12:12711817-12711839 GGATTGAGAGAGATGGAGAAAGG - Intergenic
1094633564 12:32202153-32202175 GGACTTAGAGAGAGGAAGCATGG + Intronic
1094748651 12:33378426-33378448 GGCTTCACAGGGATGATGCAGGG - Intronic
1096863066 12:54543796-54543818 GGATTCACAGAAGTGATGCATGG - Exonic
1100707619 12:97219080-97219102 GGATTTAAAGAGAGGAGTCAGGG - Intergenic
1101083059 12:101208826-101208848 GGATTAAATGAGATGATGCAAGG - Intronic
1101544895 12:105703453-105703475 GGACTCAAAGAGGTGATGAATGG - Intergenic
1102288200 12:111676734-111676756 GGATTCAAGGAGACAATGCATGG + Intronic
1102558398 12:113744518-113744540 GGATTAAAAGAGATAATGTAGGG + Intergenic
1102907055 12:116684826-116684848 GGATTCAGTGGGATGATGCATGG + Intergenic
1103081240 12:118025638-118025660 GGCTTTAAAGGGATGAAGGAAGG - Intronic
1104891675 12:132143217-132143239 GGATGCAAAGACTTGAAGCCAGG - Intronic
1105402476 13:20108037-20108059 AGATTCAGAGACATGAAGAATGG - Intergenic
1105603703 13:21909771-21909793 GGATTCTAGGGGATGAAGCAGGG + Intergenic
1105832009 13:24170993-24171015 GGATTCAGAAAGAACAAGCATGG + Intronic
1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG + Intergenic
1108684261 13:52805115-52805137 AGGCTCAGAGAGATGAAGCAAGG + Intergenic
1108938907 13:55924072-55924094 GTATGTAATGAGATGAAGCAAGG - Intergenic
1109102050 13:58198029-58198051 GGATTAAGAGAGATGAAGAAAGG + Intergenic
1109183719 13:59245418-59245440 GTATTTAAAGACATGAAACAGGG + Intergenic
1109415265 13:62031277-62031299 AGATTCATAGAGAACAAGCAGGG + Intergenic
1110770340 13:79335950-79335972 GGATTTAAAGGGATAAAGAAAGG - Intronic
1114142625 14:19932404-19932426 AGATTGAAAGAGATGAAAAAGGG - Intergenic
1114242889 14:20885241-20885263 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1114249819 14:20949179-20949201 AGATTCAAAGAGATGGAGTAAGG + Intergenic
1114987378 14:28247771-28247793 GGAAACAAAGAGAAAAAGCAAGG - Intergenic
1115272699 14:31571754-31571776 GGATTTCAAAAGATGAAGAAAGG - Intronic
1116587230 14:46722768-46722790 GGACACAAAGAGGTGATGCAAGG - Intergenic
1116678105 14:47931615-47931637 GGATTAAATGAGATAAAGCATGG + Intergenic
1116965216 14:51007522-51007544 GGATTCAAAGTCAGGGAGCATGG - Intronic
1117472560 14:56060988-56061010 GGAATTAATGAGATGAAGGATGG - Intergenic
1119030245 14:71186765-71186787 GGTGTCAGAGAGATGCAGCATGG + Intergenic
1119089006 14:71763055-71763077 GGATAAAAAGAGATTCAGCAGGG - Intergenic
1120967853 14:90183473-90183495 GGCTTAGAAAAGATGAAGCAGGG - Intronic
1121518032 14:94566700-94566722 GGATTGATAGAGAAGAAACAAGG - Intronic
1124851146 15:33339951-33339973 GGCTTAAAAGAGAAGAAGAAAGG + Intronic
1125915570 15:43484318-43484340 GGATTGAAGCAGATGAAGAATGG - Intronic
1126118408 15:45229567-45229589 GGATTCAGTGAGATAATGCATGG + Intergenic
1128789467 15:70422568-70422590 GGACTCAGAGAGATGAGACATGG + Intergenic
1129110994 15:73336994-73337016 GCATTCAAGGACATGAAGGAAGG - Intronic
1130194364 15:81765045-81765067 GAATACAAATAAATGAAGCAAGG - Intergenic
1130582330 15:85149292-85149314 GTATTCAAAAAGATGCAGTAGGG + Intergenic
1130753785 15:86741422-86741444 GAATTCAACCAGATGAAGCATGG + Intronic
1130963385 15:88679901-88679923 GGATTAAATGAGATGATGTATGG + Intergenic
1131081584 15:89541062-89541084 GGATTAAATGAGATTATGCATGG - Intergenic
1131337504 15:91563360-91563382 GGATTCAACGAGATAATACACGG + Intergenic
1131399498 15:92113146-92113168 GGGATCACAGAGATGAAGAAAGG - Intronic
1131570553 15:93531025-93531047 GAATTCAAAGAGAAGGTGCAAGG + Intergenic
1133381705 16:5336451-5336473 GGATTGAATGAGATCATGCATGG + Intergenic
1133825640 16:9275803-9275825 GGCCTCAAAGAGCTGAATCAGGG - Intergenic
1134286026 16:12862669-12862691 GGATTAAATGAGTTGATGCAGGG - Intergenic
1134826016 16:17285050-17285072 AGATGCAGAGAGAGGAAGCAGGG + Intronic
1134846345 16:17444028-17444050 GGATTCAAAGAGTTGATGAACGG - Intronic
1135002057 16:18785032-18785054 GCATGCAAAGAGATGGAACAAGG + Intronic
1135033245 16:19055866-19055888 GGATTAAAAGAGACTAAGGAAGG - Intronic
1135396094 16:22132751-22132773 GGATGGAAAGAGATGAGGCTGGG - Intronic
1135541513 16:23333602-23333624 GGATTCAATAAGATAAGGCATGG - Intronic
1137538923 16:49348827-49348849 GGATTGAATGAGATCATGCAGGG + Intergenic
1137633482 16:49965270-49965292 GGGTTCAAGGAGATAAATCAAGG - Intergenic
1137997213 16:53231092-53231114 GCATTCAATGGGATGATGCATGG + Intronic
1139314669 16:66058043-66058065 GGAATCAAAGGGTTGAAACATGG - Intergenic
1142994200 17:3751315-3751337 GGACAGAAAGAGAGGAAGCAGGG + Intronic
1143413402 17:6726590-6726612 GGATTCAAAGGGATTCAGGAAGG + Intergenic
1145122318 17:20271355-20271377 GAATGCAAAGACAGGAAGCATGG - Intronic
1145175042 17:20693095-20693117 GAATGCAAAGACAGGAAGCACGG - Intergenic
1145219464 17:21076293-21076315 GAAGTCAAAGAGATACAGCATGG - Intergenic
1147304445 17:39553645-39553667 GGATTCCTAGAAATGAAGGAGGG + Intronic
1149124868 17:53216790-53216812 TGATTCAAAGAGATGAAAAGAGG - Intergenic
1149565970 17:57640793-57640815 GGACTCACTGAGATGATGCAGGG + Intronic
1150545318 17:66151031-66151053 GGATGCAAAGAGATGTATCATGG - Intronic
1150814525 17:68382361-68382383 GGATTCAATGAGATAATGCCAGG + Intronic
1151336787 17:73444585-73444607 GGATTCAATGAGGTGATTCAGGG - Intronic
1155032837 18:21999254-21999276 GGATTCAATGAGATAATTCATGG + Intergenic
1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG + Intergenic
1156847401 18:41682495-41682517 GGATTGAAAGAGATAATCCATGG + Intergenic
1157378649 18:47190711-47190733 AGTTTCAAAGAGAGGAAGGAAGG + Intergenic
1157699372 18:49751316-49751338 GGGTTCAAAGAGATGAGACATGG - Intergenic
1158053129 18:53248000-53248022 GGATTCAAAGAGATCAGACATGG - Intronic
1158304120 18:56085783-56085805 GTGTTCAATGAGATGATGCATGG + Intergenic
1158372735 18:56827898-56827920 GGATTAAATGAGATGATGCATGG + Intronic
1160380812 18:78453950-78453972 TGATTCAATGAGATGAATCCAGG + Intergenic
1161834765 19:6638348-6638370 AGATTCAAAGAGATCCTGCATGG - Intergenic
1163669197 19:18617639-18617661 GAATCCTAAGAGATGAACCATGG - Intronic
1165127543 19:33610909-33610931 GGAATCAAAGGGAAGAAACAGGG - Intergenic
1165722411 19:38088932-38088954 GGATTCCATGAGATGAAGCTGGG - Intronic
1167679740 19:50912012-50912034 GGATTCAAAGAGGTAATTCAGGG + Intergenic
925688890 2:6499883-6499905 GAATTCATGGAGATGGAGCAAGG - Intergenic
925914103 2:8592457-8592479 GCATTCAAAGAGATGCAGCCAGG + Intergenic
926536744 2:14122500-14122522 GGAGTCAAAGAAATGAAGAAAGG + Intergenic
927695975 2:25240134-25240156 GGATAGAAAGGGAGGAAGCAGGG - Intronic
928776820 2:34775387-34775409 GCATTCAATTAAATGAAGCACGG + Intergenic
930104539 2:47629692-47629714 GAATGCCAGGAGATGAAGCAAGG + Intergenic
931829674 2:66037786-66037808 GGAATCAAAGAGATAAATTATGG + Intergenic
933814502 2:86054879-86054901 ACATTCCCAGAGATGAAGCAGGG + Intronic
934528608 2:95069802-95069824 GGATCAAATGAGATGATGCAGGG + Intergenic
934879827 2:97966492-97966514 GGAACCTAAGAGATGAAGAAGGG - Intronic
935047496 2:99495179-99495201 TCATTCCAAGAGAGGAAGCAAGG + Intergenic
935756358 2:106278881-106278903 GGATTCAAAGAAAAGTGGCAAGG - Intergenic
937164865 2:119803985-119804007 GGATGGAAAGAGATGTATCATGG - Intronic
938594622 2:132775457-132775479 GGAAAGAAAGTGATGAAGCATGG - Intronic
939472126 2:142636304-142636326 GGATACAGAGAGAAGAAGCATGG + Intergenic
939479934 2:142735070-142735092 GGATTAAATGAGATGATGTAGGG - Intergenic
945326522 2:208488649-208488671 GGATCCAAAGAGATAGAGAAAGG + Intronic
946060566 2:216937440-216937462 GGAGATAAGGAGATGAAGCAGGG - Intergenic
946478314 2:220030141-220030163 GGATTCCAAGAGATGGTACAAGG + Intergenic
946633407 2:221697155-221697177 GGATTCAAGGGGAAGAAGCAAGG + Intergenic
1169441145 20:5634931-5634953 GGATGCACAGATATGAAGAAAGG + Intergenic
1170375097 20:15691613-15691635 GGATTAAATGAGATAATGCATGG + Intronic
1170748579 20:19123540-19123562 GGATTCAAAGAAAGGAAGTAGGG + Intergenic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1172023096 20:31929116-31929138 GGATTCAAACTGTTGAATCAAGG - Intronic
1172657212 20:36544473-36544495 GGATTAAAGGAGATAAAGCATGG + Intronic
1173721545 20:45262567-45262589 ATATTCAAAGAGATAAAGAAAGG - Intergenic
1174175400 20:48641484-48641506 GGTTTAAAAGACATGAAGGAAGG + Intronic
1176950623 21:15042277-15042299 GGATAGAAACAGATGAAGGAAGG - Intronic
1177399978 21:20591308-20591330 AGATTCAAAGAGATGAAAGTAGG - Intergenic
1178278857 21:31263809-31263831 TGATTCAAAGAGATGATCTATGG - Intronic
1179299896 21:40098249-40098271 TTATTCAAAGATATGAAGCTTGG + Intronic
1180883829 22:19225469-19225491 GGATTCAAAGAGCTCCACCAGGG + Exonic
1181360477 22:22330458-22330480 GGAGTGGAAGAGATGAAGAAAGG + Intergenic
1181587119 22:23859032-23859054 GAATTCAATGAGATCATGCATGG - Intronic
1183094484 22:35543945-35543967 GGAATCAGAGAGAGGAGGCAGGG - Intronic
1183094500 22:35544040-35544062 GGAGTCAGAGAGAGGAGGCAGGG - Intronic
949762905 3:7491770-7491792 GGATTAAATAAGATAAAGCATGG + Intronic
950313987 3:11984245-11984267 GGATTAAATGAGATGATGCATGG + Intergenic
950829872 3:15862709-15862731 GAATTCTAACAGATGAAACATGG - Intergenic
950988437 3:17402830-17402852 GGATTCAAATGCATAAAGCAAGG + Intronic
950997888 3:17524095-17524117 AGATTTAAAGAGATGAACGAAGG + Intronic
951407636 3:22320255-22320277 TGATTAACAGAGATGAACCAAGG + Intronic
951739577 3:25905675-25905697 GTATAGAAAGAGATGAAGAATGG - Intergenic
952157149 3:30655748-30655770 GGATTTAAGGAGATGATGCTTGG + Intronic
952915179 3:38232462-38232484 GAATAAAAAGAGATCAAGCACGG + Intronic
953344559 3:42164590-42164612 GGATTCAATGAGATAATACAAGG - Intronic
953600733 3:44361422-44361444 GGTTTCAAAGACTTGAAGCCTGG - Exonic
956256916 3:67292943-67292965 GGATTCTCAGAGCTGAAGCTAGG + Intergenic
957023782 3:75155298-75155320 AGATGCAAAGAGAACAAGCAAGG - Intergenic
960105814 3:113795575-113795597 CTAATCAAATAGATGAAGCAAGG - Intronic
960198162 3:114796539-114796561 TAATTGAAAGAGATGGAGCAGGG - Intronic
960807417 3:121597605-121597627 GGATCCAATGAGATGAAATAGGG - Intronic
962901416 3:139765157-139765179 GGATTCAAGTAGATGATTCATGG - Intergenic
963983318 3:151564425-151564447 GGAAACAAAGAGAGGAAGGAAGG - Intergenic
964213811 3:154256900-154256922 GGTTTCATGGAGATGAAGGATGG + Exonic
964428219 3:156575694-156575716 GGACAAAAAGAAATGAAGCAGGG - Intergenic
965434644 3:168634276-168634298 GGATTCAAAGAGCTGTCTCAGGG - Intergenic
965624011 3:170668946-170668968 GGATGCAAAGAGAAAAAACAGGG + Intronic
965800553 3:172489092-172489114 CAATTCAAAGATAAGAAGCAAGG - Intergenic
966562270 3:181336120-181336142 GGATTAAATGAAATAAAGCATGG + Intergenic
967009949 3:185423397-185423419 GTCTTAAAAGAGATGAGGCAGGG + Intronic
967246782 3:187495262-187495284 GCATTCAAAAACATGAAGTAGGG + Intergenic
969231314 4:5833619-5833641 GGATTAAATGAGATGATGCATGG + Intronic
969232833 4:5843404-5843426 GGGATCAATGAGAGGAAGCAGGG + Intronic
971132338 4:23826672-23826694 GGCTTAAAAGAAATGAAACATGG - Intronic
972938207 4:44166395-44166417 TGGTTCAACTAGATGAAGCAAGG - Intergenic
973341917 4:49013969-49013991 GGATTCAAAGATGTGAATAATGG + Intronic
977189459 4:93981548-93981570 GAACACAAAGAGATGAATCAAGG + Intergenic
978158882 4:105522020-105522042 GGATTCAAAGAGAGGGAACTAGG - Intergenic
979646262 4:123074041-123074063 GAAATCAAAGAGATCAAGAATGG - Intronic
979929748 4:126616589-126616611 GGATTAAAAGGGAAGGAGCAAGG + Intergenic
980246586 4:130253122-130253144 TGATTTAAAGAGATGAGGCTGGG + Intergenic
982522038 4:156430064-156430086 GAATTAAAAGAGAAGAAACAAGG - Intergenic
982894216 4:160896498-160896520 TGATTCAAAAAGATGAAATAAGG + Intergenic
984349866 4:178576756-178576778 GTATTCAAAGACATAAAGTATGG + Intergenic
985012369 4:185596872-185596894 GGTTTGAAAGATATGAAGGAAGG - Intronic
985507605 5:292798-292820 GGATTTAAACAGAGGAACCATGG + Intronic
985740368 5:1612331-1612353 GGATTTAAACAGAGGAACCATGG - Intergenic
985931821 5:3064419-3064441 GAATTCATAGTGAAGAAGCACGG + Intergenic
987777853 5:22392628-22392650 GACTTGAATGAGATGAAGCATGG - Intronic
989469684 5:41800687-41800709 GGATTAAAAGAGACCAAGAAAGG - Intronic
989552633 5:42753873-42753895 TGATTCAAAGACAAAAAGCATGG + Intergenic
992195642 5:74336405-74336427 GGAGGCAAAGAGATGCATCAAGG + Intergenic
992701044 5:79342292-79342314 GGATTATAAGAGATGAGGGAGGG + Intergenic
992767543 5:80015142-80015164 AGATGAGAAGAGATGAAGCAAGG + Intronic
993059575 5:83023020-83023042 TTATTCAAAGAGATGAAGAATGG + Intergenic
994925216 5:106108566-106108588 GGATACAGAGAGATGCAGGAGGG - Intergenic
995389593 5:111625931-111625953 TGAGTTAAAGAGATGAAGCTGGG + Intergenic
995538770 5:113164094-113164116 GTATTCAGAGAGATAAACCAAGG + Intronic
995641278 5:114260000-114260022 GGAGGGAAAAAGATGAAGCAAGG - Intergenic
995724306 5:115168360-115168382 GGATTCATAGATATGAAGTCTGG - Intronic
997553458 5:134773810-134773832 GAAATCGAAGAGATGAAACAAGG + Exonic
997596344 5:135109643-135109665 GAATTGAATGAGATGAAGGATGG + Intronic
997751467 5:136350308-136350330 AGCCTCAAGGAGATGAAGCATGG + Intronic
997833990 5:137177698-137177720 GGACTCAAAGATAAGAAGAAGGG + Intronic
999174517 5:149622506-149622528 GGATTGAATGAGATCATGCATGG - Intronic
1000832342 5:166118605-166118627 GGGTTCAAAGAGCTGAAACAAGG + Intergenic
1003110891 6:3251397-3251419 CGATTCGAAGAGAAAAAGCAAGG - Intronic
1003493155 6:6641540-6641562 GAATTCAAAGAGATAATCCAGGG + Intronic
1005120086 6:22380066-22380088 GGAGACAAAGAGATGGGGCAGGG - Intergenic
1005807546 6:29488581-29488603 GGTTTGAAAGAGATGAGACATGG - Intergenic
1005981628 6:30841221-30841243 GGAGACAAAGATTTGAAGCAAGG + Intergenic
1006847839 6:37075246-37075268 GGATTAAATGAGATGATGTATGG - Intergenic
1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG + Intergenic
1007836459 6:44677654-44677676 GGAGTCAGAGAGATGAGGCAGGG - Intergenic
1008556605 6:52678725-52678747 GGATTAAATAAGATGATGCATGG + Intronic
1011183396 6:84647500-84647522 TGGTACAAAGAGATGAAGGATGG - Intergenic
1011322266 6:86108771-86108793 CGATTCAAACAGAGGCAGCATGG - Intergenic
1011824397 6:91289051-91289073 GGCATCAAAGAGCTGAAGGATGG - Intergenic
1012741841 6:103027154-103027176 AGCTTCGAAGAGTTGAAGCATGG + Intergenic
1013287238 6:108692073-108692095 GGATTAAGTGAGATGATGCATGG + Intergenic
1013607759 6:111766142-111766164 GGATTAAAAGAGAAGAAGTGTGG - Intronic
1014646458 6:123979732-123979754 TAATTCAAAGAGATGAATTAAGG + Intronic
1017511564 6:155118743-155118765 GGATTCCATTAGATGAAGAAAGG - Intronic
1017899655 6:158708433-158708455 GGATAGAAGGAGAGGAAGCAGGG + Intronic
1018003711 6:159601589-159601611 GGAGAAAAAGAGATGAAGAAAGG + Intergenic
1018866601 6:167751424-167751446 GGATGCAGAGAGTTGATGCACGG + Intergenic
1020977520 7:15025230-15025252 GGACACAAAGAGCTGAAGAAGGG + Intergenic
1021742714 7:23703950-23703972 GGAGTCAATGAGAGGAAACAAGG - Intergenic
1021796440 7:24259285-24259307 GAATGCCAAGAGATGAAGCAGGG - Intergenic
1023714028 7:43024902-43024924 GGCTTCCCAGAGTTGAAGCAGGG + Intergenic
1023772718 7:43573059-43573081 AGATTCAAATATATGAATCAGGG + Intergenic
1024772338 7:52737683-52737705 GGAATAAAAGATAAGAAGCAGGG - Intergenic
1024834346 7:53498560-53498582 GGAATCAAAGAAATGAAAGAAGG - Intergenic
1027640833 7:80731854-80731876 TGATTCCAAGAGTTGAAGCTTGG - Intergenic
1028204693 7:88003054-88003076 GAATAAAAAGAGTTGAAGCAGGG + Intronic
1028600735 7:92597721-92597743 GCATTGAAAGAGAAGAAGCGTGG - Intergenic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1030106505 7:105991941-105991963 GGCTACAAAGTGATGAACCAGGG + Intronic
1030883506 7:114911349-114911371 GGATAAAAAGAGATGGACCAAGG + Intergenic
1032498724 7:132383132-132383154 GGCTTCAGAGAGAGGGAGCATGG - Intronic
1034033637 7:147796726-147796748 GGATGCACAGAGATGCTGCAGGG + Intronic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1034951395 7:155298830-155298852 GGATTTAGAGAAATGAAGGAGGG + Intronic
1037637077 8:20709754-20709776 GGATTCAAAAAGATAAAGTGAGG + Intergenic
1038201066 8:25413167-25413189 GGTTTCAATGAGATGAAATATGG + Exonic
1039501439 8:38020768-38020790 GGATTCCCAGTGGTGAAGCAGGG + Intergenic
1043385546 8:79744233-79744255 GGGGTCACAAAGATGAAGCAGGG - Intergenic
1044123118 8:88422860-88422882 GGATTTATAGGGAAGAAGCAGGG - Intergenic
1044917949 8:97136189-97136211 AGATTCATAGAGAAGGAGCAAGG + Intronic
1047933103 8:129749997-129750019 GGCTTCAAGGAGATAAAGAATGG + Exonic
1048108671 8:131442146-131442168 GGATTCAATGAGATGATCCCGGG - Intergenic
1048162839 8:132036956-132036978 GGATTAAATGAGAGCAAGCATGG - Intronic
1048460133 8:134614668-134614690 GTGTTCAAAAAGATGAAGCTAGG + Intronic
1051786301 9:20747732-20747754 GGATTAAAAGGAATGAAGTATGG - Intronic
1056034166 9:82585813-82585835 GGATTAAACGAGATAAAGAATGG + Intergenic
1057125432 9:92612546-92612568 GGATACAAATAGATGAAGATGGG + Exonic
1057130067 9:92648831-92648853 GGAAGCAGAGAGCTGAAGCAAGG + Intronic
1059108808 9:111535185-111535207 GGATTCATAGAGCAGCAGCAGGG + Intronic
1060207630 9:121691616-121691638 AGATTCAATGAGATCACGCATGG - Intronic
1060781842 9:126418764-126418786 GAAATCAGAGAGATGCAGCAGGG - Intronic
1061000106 9:127898059-127898081 GGATTCAAGCAGATGTGGCAAGG + Intronic
1061571163 9:131478176-131478198 GGCTTTAAAGAGAGGAAGCCTGG + Intronic
1061751063 9:132777303-132777325 GGATTCAATGGGATGATGCGGGG - Intronic
1061773556 9:132945465-132945487 AGAATCAAGGAGATGAAGTATGG + Intergenic
1186707276 X:12154920-12154942 GGGTTCAGAGGCATGAAGCAGGG + Intronic
1187190819 X:17033285-17033307 GGATTGAAACAAATGAGGCAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187577938 X:20578084-20578106 TGATTAAAAGAGATCAAGAATGG + Intergenic
1188443077 X:30231788-30231810 GGCTTCAAAGACCTGAAACAGGG - Intronic
1188443379 X:30233525-30233547 GGCTTCAAAGACCTGAAACAGGG - Intronic
1188581456 X:31718841-31718863 GGATTCAATGAAATGACGCATGG - Intronic
1189712478 X:43827617-43827639 AGATTCATAGAGAGGAGGCATGG + Intronic
1189859358 X:45257358-45257380 GGATGAAATGAGATGATGCAGGG + Intergenic
1189912713 X:45827352-45827374 GGATTAAAAGAAATGATGTATGG - Intergenic
1190403054 X:50058179-50058201 GCATTCAAAGAAATGGGGCAGGG - Intronic
1190417686 X:50197303-50197325 GGACTGAAAGAGATAAAACATGG - Intronic
1190513666 X:51200649-51200671 GGAAACAAAGAGATAAATCATGG + Intergenic
1191970492 X:66809868-66809890 GAGTTTAAGGAGATGAAGCAAGG - Intergenic
1192194788 X:69021063-69021085 GGACCCAGAGAGAAGAAGCAAGG + Intergenic
1194407882 X:93520364-93520386 GGATTCTAAGAGAGCAAGCTGGG + Intergenic
1195888349 X:109665920-109665942 GGATTAAATGAGATGATACATGG + Intronic
1196071907 X:111534070-111534092 GCTTTCAATGGGATGAAGCAGGG + Intergenic
1197592734 X:128428499-128428521 TGATTGACAGAAATGAAGCATGG - Intergenic
1197593866 X:128443473-128443495 GGAATCAAAAAAATGTAGCAGGG - Intergenic
1197882114 X:131177911-131177933 GGATTAAATGAGATAATGCATGG + Intergenic
1198146710 X:133864546-133864568 GTATTCATAGAGATTAGGCATGG - Intronic
1199622660 X:149713899-149713921 GGATGAAAACAGAGGAAGCAAGG - Intronic
1199662239 X:150063545-150063567 GGATTCAATGAGAGAATGCATGG - Intergenic
1200277987 X:154751861-154751883 GGATTCAATGAGATAACGCCTGG - Intergenic
1200872186 Y:8113356-8113378 GGAGTCAAAGAGCTGTAACAAGG + Intergenic
1201711294 Y:16995797-16995819 GGATTGAAATACTTGAAGCATGG - Intergenic