ID: 1028911216 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:96209468-96209490 |
| Sequence | ACACATATTTAACACCCCTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1028911215_1028911216 | -3 | Left | 1028911215 | 7:96209448-96209470 | CCATTAGGAAAAAATTTGACACA | No data | ||
| Right | 1028911216 | 7:96209468-96209490 | ACACATATTTAACACCCCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1028911216 | Original CRISPR | ACACATATTTAACACCCCTA AGG | Intronic | ||