ID: 1028918546

View in Genome Browser
Species Human (GRCh38)
Location 7:96286406-96286428
Sequence CAGAGTGCCACAGGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028918546_1028918550 21 Left 1028918546 7:96286406-96286428 CCCTCCACACCTGTGGCACTCTG 0: 1
1: 0
2: 0
3: 20
4: 282
Right 1028918550 7:96286450-96286472 GTTGTTTTCTTTGCCTAAAAAGG 0: 1
1: 0
2: 3
3: 37
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028918546 Original CRISPR CAGAGTGCCACAGGTGTGGA GGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901051545 1:6428136-6428158 CAGACTCCCACAGGCCTGGAAGG - Intronic
901177988 1:7318627-7318649 CAGAATTCCACAGGAGAGGATGG + Intronic
901537082 1:9889471-9889493 CAGAGGCCCAGAGATGTGGAGGG - Intronic
901940055 1:12655220-12655242 TACAGTGTCACAGGTGTTGATGG - Intronic
902228795 1:15014189-15014211 CAGAATCCTGCAGGTGTGGATGG - Intronic
902315921 1:15618092-15618114 CAAAGAGCCAAAGGTGGGGAGGG - Intronic
902482775 1:16720225-16720247 CAGACTCCCACAGGCCTGGAAGG + Intergenic
903065994 1:20699836-20699858 CAGATTGTGACAGCTGTGGAGGG + Intronic
903267241 1:22165150-22165172 CACAGTTCCACACGAGTGGAGGG + Intergenic
903576926 1:24345043-24345065 TGGAGGGGCACAGGTGTGGAGGG - Intronic
903576993 1:24345260-24345282 TGGAGGGGCACAGGTGTGGAGGG - Intronic
903785958 1:25861553-25861575 CAGAGACCAAGAGGTGTGGAAGG - Exonic
904315394 1:29656692-29656714 CAGAGTGCCAAATGTGTGAGAGG + Intergenic
904604333 1:31690636-31690658 CAGAGGGGCACGGGTGGGGAAGG - Intronic
905262594 1:36730160-36730182 CACAGAGCCACAGGTATGTACGG - Intergenic
905532981 1:38696705-38696727 CAAAGTGCTACAGGGGAGGAAGG - Intergenic
906522781 1:46477194-46477216 CAGAGGGGCACAGGTGAGAAGGG - Intergenic
906635417 1:47406498-47406520 CAGAAGGTCACAGCTGTGGAAGG - Intergenic
907594150 1:55704238-55704260 CAGAGTGCTGCTGGTGTGCATGG + Intergenic
911070002 1:93824998-93825020 CAGAGAGCCACAGATGGGTATGG - Intronic
913135056 1:115880270-115880292 GAGAGTACCACAGGAGTGTATGG + Intergenic
913398240 1:118396875-118396897 CAGAGTGCAGCAGGTGAGCAGGG - Intergenic
915649984 1:157302679-157302701 CAGAGTGCCACAGGACAGGCAGG + Intergenic
916550365 1:165844331-165844353 CACAGTACCACAGGTGCTGAAGG - Intronic
918163731 1:181924862-181924884 GAGAGTGGCAAAAGTGTGGAGGG - Intergenic
920038510 1:203081308-203081330 TAGAATTCCACAGGTGTGAATGG - Intergenic
920403466 1:205692079-205692101 CAGAGGGGGAAAGGTGTGGAGGG - Intergenic
921254980 1:213330932-213330954 CAGATTGCCTCAGTTGTGAATGG - Intergenic
922218925 1:223543248-223543270 GAGAGTTCCGCAGGTGGGGATGG - Intronic
922532964 1:226358310-226358332 CAGAATGCCACAGTGGTGGGTGG + Intergenic
922613583 1:226947263-226947285 CTGAGTCAGACAGGTGTGGAAGG + Intronic
922919630 1:229291376-229291398 CAGAATGGCACAGGTCTAGAGGG + Intronic
923440249 1:234011826-234011848 GATATTCCCACAGGTGTGGAGGG - Intronic
923470521 1:234286414-234286436 CCGAATGCCACAGGTGGGAAAGG + Intronic
1064053408 10:12077845-12077867 CAGAGTGCCAGAGGTCTCGGTGG + Intronic
1064954613 10:20894034-20894056 CAGAGTGGTACAGATGTGGACGG - Intronic
1067737910 10:48873197-48873219 CAGAAAGCAACAGGTCTGGAAGG - Intronic
1069020847 10:63486826-63486848 GGGAATGCCACAGGTGTGGAAGG - Intergenic
1070636663 10:78134139-78134161 GAGAGGGCCACTGCTGTGGATGG + Intergenic
1075152757 10:119949315-119949337 CAGAGTGACTCAGGCGTGAACGG + Intergenic
1075721250 10:124588863-124588885 CACTGTGCAACATGTGTGGAGGG - Intronic
1075930034 10:126288083-126288105 CAGTGTGTGACAGGTGAGGAGGG - Intronic
1076097203 10:127740974-127740996 CAGAGTGCCAGTTGTGTTGAAGG + Exonic
1076555316 10:131317658-131317680 CAGAGGGGCACATGTGTGGCAGG - Intergenic
1076926891 10:133495427-133495449 CAAAGTTCCACAGGTCTGTAGGG + Intergenic
1077205229 11:1338824-1338846 CAGAGTCCCACGGGGGTGGGGGG + Intergenic
1077402744 11:2367184-2367206 GAGAGAGCCACAGCTGTAGAGGG - Intergenic
1077736172 11:4793961-4793983 CAGGGTGACACAAATGTGGAAGG + Intronic
1079262945 11:18901040-18901062 GAAACTCCCACAGGTGTGGAGGG + Intergenic
1080948146 11:36998176-36998198 CTGAGTCCCACAGATGTGAAGGG - Intergenic
1084178937 11:67437172-67437194 CTGAGGGCCACAGGCGTGCAGGG + Intronic
1084207570 11:67604868-67604890 CAGAGTGACACAGGATGGGATGG + Exonic
1084590346 11:70086521-70086543 CAGTGAGCCACTGGTATGGATGG - Intronic
1085851156 11:80121875-80121897 CAGAGTTCCACAGGACTGGTTGG - Intergenic
1087222422 11:95560632-95560654 CAGAGTCCCACAGTGGTGCAGGG - Intergenic
1087229951 11:95649905-95649927 CTGATTGCCACACTTGTGGAAGG + Intergenic
1087464839 11:98491138-98491160 CACAGTTCCAAAAGTGTGGAAGG + Intergenic
1089384596 11:118059501-118059523 CAGAGTGCAGAATGTGTGGAAGG + Intergenic
1089744353 11:120606651-120606673 GAGAGTGCCGCAGGTGTTGGGGG + Intronic
1090064811 11:123493573-123493595 CAGAGTGGCAGTTGTGTGGACGG + Intergenic
1090851732 11:130576591-130576613 GAGAGTGAGACAGGTGTGGATGG + Intergenic
1091153998 11:133356746-133356768 CACGGTGTCACAGGTGTGGCAGG + Intronic
1091773067 12:3165951-3165973 CAGATTTGCCCAGGTGTGGATGG + Intronic
1095127716 12:38501750-38501772 CAGAGGGCCACAAGTGTGCTTGG + Intergenic
1096526456 12:52212947-52212969 CAGAGACCCACAAGGGTGGACGG - Intergenic
1097713135 12:62936385-62936407 GAGAGTGGCCCAGGTGTTGAAGG + Intergenic
1102383376 12:112486160-112486182 CTGAGTGCCACAGGGATGCAGGG + Intronic
1104376426 12:128267921-128267943 CACAGTGCCGAAGCTGTGGATGG - Intronic
1104702489 12:130917848-130917870 AAGAGAGCCACAGGTGGGGTGGG + Intergenic
1105019399 12:132805850-132805872 CAGAATGCCAGACGTGTAGAGGG + Intronic
1105365113 13:19757235-19757257 CACAGTTCCAAAAGTGTGGAGGG - Intronic
1106096199 13:26646517-26646539 GGGAGTGACACAGGTGTGGGGGG - Intronic
1106141435 13:27015203-27015225 CAGAGTGGCGGAGGTGAGGAAGG - Intergenic
1106183309 13:27386636-27386658 CGGAGGGCCAGAGGTCTGGAGGG + Intergenic
1106208517 13:27620858-27620880 AAGAGTGGCACAGCTGGGGAAGG + Exonic
1107963617 13:45579868-45579890 CAGAGTGCCCTGGGTGGGGAAGG - Intronic
1107997529 13:45875415-45875437 CAGAGAGTTACAAGTGTGGATGG - Intergenic
1109798758 13:67347573-67347595 GAGAATGCTACAGGTTTGGAGGG - Intergenic
1110688280 13:78401173-78401195 CACAGTGTGACAGCTGTGGACGG + Intergenic
1110839695 13:80127808-80127830 CTGAGTGACTGAGGTGTGGAGGG + Intergenic
1113051923 13:106221774-106221796 CAGAGTGGCACAGGTGCTGGGGG - Intergenic
1113070981 13:106421025-106421047 AACAGTCCCACAGGTGTGGTTGG + Intergenic
1115645745 14:35367455-35367477 CACAGAGCCCCTGGTGTGGAAGG - Intergenic
1116644511 14:47509574-47509596 CAGAGAGCCACTGGGGTGGGGGG + Intronic
1118169321 14:63371037-63371059 CAGGGTGTCACAGGTGGGGCAGG - Intergenic
1121340250 14:93100719-93100741 CCTAGAGCCACAGGGGTGGATGG - Intronic
1121631474 14:95424199-95424221 CAGAAAGCCACAGGTGTGAGAGG + Intronic
1122129329 14:99596022-99596044 CAGAGGGCCCCAGGTGGGCAGGG + Intronic
1123707134 15:22958808-22958830 CAGAGTGCCCCAGGAGGGCAAGG + Intronic
1125605604 15:40938206-40938228 CAGACACCCAAAGGTGTGGAAGG - Exonic
1127235871 15:57051379-57051401 CAGAAAGCCACAGCTGAGGAAGG - Intronic
1128690531 15:69721388-69721410 GAGAGTGCTGCAGGTCTGGAGGG + Intergenic
1130977515 15:88788863-88788885 CAGTGTGCCTCTGCTGTGGAGGG - Intergenic
1131245605 15:90789560-90789582 CAGAGTGCCATAAATGTAGATGG + Intronic
1131462593 15:92629099-92629121 CTGAGGAACACAGGTGTGGAAGG + Intronic
1131724523 15:95207126-95207148 CAGAGGGCCAGAGGTTTAGAAGG + Intergenic
1133527075 16:6616048-6616070 CAGACTGTCATCGGTGTGGAGGG + Intronic
1133916242 16:10112314-10112336 CTGATTGACACTGGTGTGGATGG + Intronic
1134106824 16:11491584-11491606 CAGAATACCAAAGGGGTGGAGGG + Intronic
1134640031 16:15822889-15822911 CACAGTCCCACAGGGGTTGAGGG + Intronic
1136143416 16:28301473-28301495 CAGACTGCCCCTGGTGGGGAGGG + Intronic
1136233339 16:28900544-28900566 CAGAGAGCCACAGGTCAGGTGGG - Intronic
1136356601 16:29748336-29748358 CTGCTTGCCAGAGGTGTGGAGGG + Intergenic
1137720510 16:50625020-50625042 CAGGGTCACACAGCTGTGGAGGG + Intronic
1138451159 16:57093965-57093987 CAGAGGGCCACAGGGGGGGAGGG - Intronic
1139264221 16:65623986-65624008 CAGTGTCACACAGGTGTGGATGG + Intergenic
1142262455 16:89049354-89049376 CACAGGGACAGAGGTGTGGACGG + Intergenic
1142645170 17:1307080-1307102 CGGAGTGGTCCAGGTGTGGAAGG + Intergenic
1146449960 17:32965055-32965077 GAGAGTGCTGCAGGTTTGGAGGG + Intergenic
1147165701 17:38592081-38592103 CAGAGGGCCCCAGGCTTGGAAGG + Intronic
1147376084 17:40023176-40023198 CAGGGTGTCAAAGATGTGGATGG + Exonic
1147387421 17:40090600-40090622 CAGAGTGCTAAAGGGGTGGAGGG - Intronic
1148293687 17:46479907-46479929 AAGAATGCCAAAGGTTTGGATGG + Intergenic
1148315872 17:46697610-46697632 AAGAATGCCAAAGGTTTGGATGG + Intronic
1151973812 17:77472709-77472731 CAGAGTGTCTCAGGAGGGGAAGG + Intronic
1152128058 17:78459290-78459312 CAGGGTGGCACAGCTCTGGAGGG + Intronic
1152135485 17:78500877-78500899 CTGAATGCCACAGGTGGGAAAGG - Intronic
1152470340 17:80487619-80487641 GGGAGTGACACAGGAGTGGAAGG - Intergenic
1156447573 18:37248829-37248851 CTGAGTGCCACAGGGGAGCAGGG - Intronic
1156995245 18:43457952-43457974 CACAGTTCCACATGTCTGGAGGG + Intergenic
1158228853 18:55231005-55231027 CTGTCTGCCACAGGTGTGTATGG + Intronic
1160771186 19:831912-831934 CGGAGCGCCGGAGGTGTGGAGGG - Exonic
1160986255 19:1840310-1840332 CGGTGTGCTGCAGGTGTGGAGGG - Intronic
1161295700 19:3519188-3519210 CAGAGGGTGGCAGGTGTGGACGG - Intronic
1161677036 19:5657335-5657357 CAGAGTCCCATAGGTGAGTAGGG + Exonic
1161722453 19:5910715-5910737 CAGAGGCCCAGAGGTGTGAAGGG + Exonic
1162348301 19:10134207-10134229 GAGAGTGCCTCAGGTATGGTGGG - Exonic
1164291331 19:23871520-23871542 CAGTGTGGCACTGATGTGGAAGG + Intergenic
1164798830 19:31058833-31058855 CAGAAAGCCACAGGTCTGAATGG - Intergenic
1167709804 19:51103762-51103784 CAGATTGCCAAAGGGGTGGGAGG - Intronic
1168000818 19:53444724-53444746 GAAATAGCCACAGGTGTGGAGGG + Intronic
926936176 2:18088313-18088335 AAGAATGCCACAGGTTTGGAGGG - Intronic
927908755 2:26881359-26881381 CACTGTGCCACAGGGGTGGCAGG - Intronic
929570288 2:43018645-43018667 CACAGTGGCATGGGTGTGGAGGG + Intergenic
932437443 2:71710941-71710963 CAGACTGCCAGAGGTGGGAAGGG - Intergenic
933102759 2:78281652-78281674 CAAAGTTCCACAGGTCTGTAGGG - Intergenic
934889844 2:98057833-98057855 CAGAGTGCCAAAGGAGTCCATGG + Intergenic
936661746 2:114550564-114550586 TACAGTGCCAGAGGTGAGGAAGG - Intronic
938763016 2:134442254-134442276 CACAGAGCCACAGGTATAGATGG + Intronic
939220203 2:139291927-139291949 CAGAGTGGCACAGATGAGGGTGG + Intergenic
940651715 2:156447290-156447312 CAGATTCCAACAGTTGTGGAGGG - Intronic
942458023 2:176151148-176151170 CAGAGTGCCCCAGGCGAGGAGGG - Exonic
945404133 2:209424285-209424307 CATAGAGCCAGAGGTGGGGACGG - Intronic
948116778 2:235499142-235499164 CAGAGGGCCAGAGGTGAGGTCGG - Intronic
948608439 2:239151502-239151524 CAGAAGGCCCCAGGTGAGGAGGG + Intronic
1169522454 20:6388108-6388130 CAGAGTGCAACATGTGTGTGTGG + Intergenic
1170798285 20:19569414-19569436 AGGAGGGCCACAGGAGTGGAAGG - Intronic
1171255829 20:23688460-23688482 CAGCGTCCAGCAGGTGTGGATGG - Intronic
1171263165 20:23750376-23750398 CAGGGTCCAGCAGGTGTGGATGG - Intronic
1171266455 20:23775666-23775688 CAGGGTCCAGCAGGTGTGGATGG - Intergenic
1171278675 20:23879172-23879194 CAGGGTCCAGCAGGTGTGGATGG - Intronic
1171283765 20:23921663-23921685 CAGGGTCCAGCAGGTGTGGATGG - Intergenic
1173488870 20:43462542-43462564 CATTGTGCCACAGGTGTGACTGG + Exonic
1174530421 20:51208379-51208401 CAGAGTGAGACAGGAGTGGTGGG + Intergenic
1175064027 20:56270003-56270025 CAGAGGGCAACAGGCTTGGAGGG + Intergenic
1175798081 20:61784970-61784992 CAGCGTGGCTCAGGTGTAGAAGG - Intronic
1175919928 20:62446094-62446116 CAGAGGGGCACAGGTGGCGAGGG + Intergenic
1175919956 20:62446164-62446186 CAGAGGGGCACAGGTGGCGAGGG + Intergenic
1175919970 20:62446201-62446223 CAGAGGGGCACAGGTGCTGAGGG + Intergenic
1175919984 20:62446238-62446260 CAGAGGGGCACAGGTGGCGAGGG + Intergenic
1175919999 20:62446275-62446297 CAGAGGGGCACAGGTGGTGAGGG + Intergenic
1175920014 20:62446312-62446334 CAGAGGGGCACAGGTGGTGAGGG + Intergenic
1176169457 20:63690429-63690451 CAGAGGTCCTCAGGTGCGGACGG + Exonic
1176256323 20:64154922-64154944 CAGAGTGCTGCATGTGAGGATGG + Intronic
1177201744 21:17964859-17964881 CACAGTGCCACAGATGTGTTGGG + Intronic
1178153310 21:29821417-29821439 CAGAGTGCCACTGGTGATGCTGG - Intronic
1178753531 21:35326327-35326349 CAGTGTGGGGCAGGTGTGGAGGG + Intronic
1180618794 22:17146286-17146308 GAGGGCGCCACAGGTGTGGAGGG - Intronic
1180799093 22:18623582-18623604 CAGCCTGACACATGTGTGGATGG + Intergenic
1181040256 22:20188660-20188682 CAGGCTGGCCCAGGTGTGGAGGG - Intergenic
1181222625 22:21371684-21371706 CAGCCTGACACATGTGTGGATGG - Intergenic
1182208915 22:28657165-28657187 CAAAGTCACACAGTTGTGGAGGG + Intronic
1182830604 22:33302025-33302047 AAGAGTCCCAGAGGGGTGGAGGG + Intronic
1182961119 22:34476202-34476224 CATAATGCTACAGGAGTGGATGG - Intergenic
1183988875 22:41584791-41584813 CAGAGGCCCACAGGTGTGACTGG - Intronic
1184325235 22:43778124-43778146 CACTGTGCCACAGGGCTGGAAGG - Intronic
952068428 3:29601933-29601955 CAGAGTTCCCAAGGTGGGGAAGG - Intronic
952289355 3:32000447-32000469 CAGAGGCCCACTGGTGTGGTGGG - Intronic
952841668 3:37651855-37651877 CAGGGTGACAGAGGTGAGGAGGG + Intronic
952852212 3:37738725-37738747 CAGGCTGCCTCAGGTGTGGAAGG - Intronic
955675310 3:61442140-61442162 AACAATGCCACAGGTGTGGGGGG + Intergenic
957067620 3:75538709-75538731 CAAATACCCACAGGTGTGGAGGG + Intergenic
958858810 3:99420248-99420270 GAAAGACCCACAGGTGTGGAGGG + Intergenic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
962887241 3:139638805-139638827 CAGAGTGAAACTGGTGGGGAAGG - Intronic
963576580 3:147067973-147067995 CACAGTTCCAAAAGTGTGGAGGG - Intergenic
964033813 3:152171150-152171172 CAAAGTGCCACTGGTGAGGAAGG + Intergenic
964914561 3:161824419-161824441 CAGGGTGACACTGATGTGGATGG - Intergenic
965931278 3:174045249-174045271 CACAGTTCCACAGGGATGGAAGG + Intronic
966735294 3:183182313-183182335 CCGGGTGCCACAGGTGAGGGTGG + Intronic
966880232 3:184345841-184345863 AAGAGGGCCACAGGGGTGGCCGG + Intronic
968660642 4:1797433-1797455 CAGATGGCCACTGGTGTGGCTGG + Intronic
968812702 4:2807190-2807212 CAGAGGTCCAGGGGTGTGGAAGG + Intronic
972393380 4:38634328-38634350 CTGAGTGTCCCAGGTGTGGTGGG - Intergenic
975519623 4:75286612-75286634 CATATACCCACAGGTGTGGAGGG - Intergenic
975732897 4:77354771-77354793 CTGAGGGCCACAGTAGTGGAGGG + Intronic
977486047 4:97647798-97647820 CAGAGGGAAACAGGTGTGAATGG + Intronic
979349699 4:119629117-119629139 CAGAGTGCCCCAGGGAGGGAAGG + Intergenic
980302068 4:131008397-131008419 CACAGTTCCAAAAGTGTGGAGGG + Intergenic
980586515 4:134823623-134823645 TAGAGAGCCACATGCGTGGAAGG - Intergenic
980937061 4:139235666-139235688 CACAGTTCCAAAAGTGTGGAGGG + Intergenic
981503866 4:145479607-145479629 CAGAGTGCTAAAGGAGGGGAAGG + Intergenic
983090418 4:163495152-163495174 CAGAGAGGCAGAGGTGTGTAGGG - Intronic
983469335 4:168137093-168137115 CAGTGTCCCACAGTTGTGCAGGG + Intronic
984011831 4:174380950-174380972 GAGAAGCCCACAGGTGTGGAGGG + Intergenic
984318635 4:178161800-178161822 CAGAGTGCCACAGATTTCTAGGG + Intergenic
985478226 5:91745-91767 CAGATTTCTGCAGGTGTGGACGG - Intergenic
985665241 5:1178726-1178748 CAGAGAGCTACAGGGGTAGAAGG + Intergenic
988142875 5:27265668-27265690 CAGAGTTCCACAGGACTGGGGGG - Intergenic
990732175 5:58821177-58821199 GAGAGTGTCACAGTTGTGTAAGG - Intronic
991625267 5:68594486-68594508 CAGAGTGGAACTGGTATGGATGG + Intergenic
994600857 5:101902975-101902997 CAGAATGCCACATATATGGAAGG - Intergenic
996021162 5:118592249-118592271 GGGAGTGACACAGATGTGGATGG - Intergenic
996284262 5:121770131-121770153 CAGAGTGCAAGAGTAGTGGAGGG + Intergenic
997554428 5:134783118-134783140 CAGGGAGACACTGGTGTGGAAGG - Intronic
997878679 5:137571015-137571037 CAGGGTGGCCCAGGTGGGGAGGG + Intronic
999132791 5:149297323-149297345 CAGAGTGGCACAGCTCTGGGGGG - Intronic
999394480 5:151218397-151218419 CCGAGTGCCAGCCGTGTGGACGG + Intronic
999776640 5:154817208-154817230 CAGAGTACCTCCTGTGTGGAAGG + Exonic
1001097819 5:168789431-168789453 CAGGTTGCCACAAGTGTGTAAGG + Intronic
1001473831 5:172035268-172035290 AAGAGAGCCTCAGGTGTGGACGG + Intergenic
1003681997 6:8265822-8265844 CAGGGTGCTCTAGGTGTGGAGGG + Intergenic
1003967181 6:11264077-11264099 CAGAGTTCCCCGGATGTGGAAGG + Intronic
1004302969 6:14475078-14475100 CAGAGGGCCACAGGAGTGGCAGG - Intergenic
1005905072 6:30255365-30255387 CAGAGTGCCACAGATCTCTAGGG + Intergenic
1006079340 6:31556278-31556300 CAGAATGGCCCAGGTGTGGCTGG - Intronic
1006298117 6:33179050-33179072 GTGAGTGCCCCAGGGGTGGATGG - Intronic
1007236262 6:40392993-40393015 CAGAGTGACAGAGATGGGGAGGG + Intronic
1007452411 6:41950238-41950260 CACAGGGCCTCAGGTGTGGAAGG + Intronic
1007572412 6:42902649-42902671 GAGATACCCACAGGTGTGGAGGG - Intergenic
1008541204 6:52547730-52547752 CAGGGTGCCAAAGGGGTGGAGGG + Intronic
1012254357 6:97015535-97015557 CAGAGTTCCACAGGTCTCTAGGG - Intronic
1013189444 6:107789721-107789743 CAGAGCACCACACCTGTGGAAGG + Intronic
1013675223 6:112452549-112452571 CAGAGGGCAACAATTGTGGATGG - Intergenic
1014082723 6:117306339-117306361 GAGAGTCCCTCAGGTGTGGGAGG - Intronic
1016177259 6:141096225-141096247 CAAATACCCACAGGTGTGGAAGG - Intergenic
1016307346 6:142697738-142697760 CTGAGAGCCACAGGAGTGGAGGG - Intergenic
1019352051 7:558963-558985 CCTGGTGCCACAGGCGTGGACGG + Intronic
1019613897 7:1950188-1950210 CAGAGTCACACAGTTGTGGCTGG - Intronic
1019880887 7:3859758-3859780 GTGAGTGACACAGGTGTGGTGGG - Intronic
1022374745 7:29802857-29802879 CAGAGTGGGTCAGGTTTGGAAGG + Intergenic
1022597157 7:31723617-31723639 CAGAGGACAACAGGTGTGGAAGG - Intergenic
1023164851 7:37333405-37333427 CAGAGTGGCAGTGTTGTGGAAGG + Intronic
1026685321 7:72504730-72504752 CAGAAGACCACAGATGTGGAAGG - Intergenic
1026967217 7:74447917-74447939 CAGAGGACCAAAGGTGAGGATGG - Intergenic
1028918546 7:96286406-96286428 CAGAGTGCCACAGGTGTGGAGGG - Intronic
1029005391 7:97203701-97203723 CAGAGAGCCAAAGGAGTTGATGG - Intergenic
1030386648 7:108874936-108874958 CTGACAGCCACAGGTGTGTACGG + Intergenic
1032889984 7:136183755-136183777 CAGCCTACCACAGGTGTGTAGGG - Intergenic
1033212204 7:139468335-139468357 GAAAGACCCACAGGTGTGGAGGG + Intronic
1033482035 7:141752065-141752087 GAAACAGCCACAGGTGTGGAGGG + Intronic
1034459615 7:151191287-151191309 GAGAGGGCTGCAGGTGTGGAGGG - Intronic
1035680245 8:1482720-1482742 CCGAGGGCTACAGCTGTGGAAGG - Intergenic
1036482691 8:9151886-9151908 CAGAGCGCCCCAGATATGGAGGG + Exonic
1039719915 8:40152109-40152131 CAGAGTTGTACAGGAGTGGAAGG - Intergenic
1040483684 8:47850751-47850773 CTGTGTGCCACAGGTGCTGAGGG + Intronic
1041666930 8:60454841-60454863 CAGAGTGCTACAGGTGTAGCAGG + Intergenic
1043451929 8:80376474-80376496 AAGAGTACCACAGGTGAGGCTGG + Intergenic
1043941366 8:86199130-86199152 CAGGGTGGGACAGGGGTGGACGG - Intergenic
1044407184 8:91841288-91841310 CAGATGTCCAAAGGTGTGGAGGG + Intergenic
1045300122 8:100903612-100903634 CAGAGGGCGATAGGTATGGAGGG - Intergenic
1046391365 8:113577042-113577064 CACAGTTCCACAGGGCTGGAGGG - Intergenic
1047561017 8:125988203-125988225 GAGAATGCTACAGGTTTGGAGGG + Intergenic
1048842526 8:138578206-138578228 CAGATGGCCACAGGCATGGAAGG + Intergenic
1049143678 8:140981356-140981378 CAGAGTGGCACCGGTGTGAGGGG + Intronic
1049509970 8:143022450-143022472 CAGAGCACCCCAGGTTTGGAGGG + Intronic
1051569540 9:18540395-18540417 GAGAGTGACACAGGGATGGAGGG + Intronic
1052857626 9:33416985-33417007 CTGTGTGCCACAGGTGCGAAGGG - Intergenic
1053463000 9:38285026-38285048 CAGGGTGCCAGTGGGGTGGAGGG - Intergenic
1053470040 9:38339888-38339910 AGGGGGGCCACAGGTGTGGATGG + Intergenic
1055442544 9:76350916-76350938 CAGAGTGGGAGAGGTATGGAGGG + Exonic
1059042223 9:110827180-110827202 GAAACTCCCACAGGTGTGGAGGG + Intergenic
1060108997 9:120893355-120893377 CAGAGGGGCCCTGGTGTGGAGGG - Intronic
1060208230 9:121694960-121694982 CAGAGTGCCCCATCTGGGGAGGG + Intronic
1060548049 9:124472089-124472111 CCGAGGGGCACAGGTGAGGATGG - Intronic
1060716549 9:125935595-125935617 CACAGTGTCACAGGTGAGAAAGG + Exonic
1061091882 9:128431148-128431170 CTGAGGGACACAGGTGTGGCGGG - Intronic
1061155352 9:128857419-128857441 GAGATACCCACAGGTGTGGAGGG + Intronic
1061712629 9:132498553-132498575 CAGGGTGGCACAGGAGTGGGTGG - Intronic
1061763480 9:132867001-132867023 CCGAGTACCGCAGGTGTGGGAGG - Intronic
1062091589 9:134681238-134681260 CAGAGAGCCACAGTTCTTGAAGG - Intronic
1062108051 9:134766451-134766473 CAGGGTGTCACGGGTATGGACGG + Exonic
1062465519 9:136679235-136679257 CAGAGTGCCAGGGCTGGGGAGGG - Intronic
1186186679 X:7027108-7027130 CAGTGTGTCACACGTGTGCATGG - Intergenic
1186192796 X:7082685-7082707 CAGAATCCCACAGGTGTGTCTGG - Intronic
1187007871 X:15249736-15249758 CAGAGTGGCAGAGGTGGGGTGGG + Intronic
1187460899 X:19485803-19485825 CACAATGCCATAGGTCTGGAGGG + Intronic
1187799263 X:23042236-23042258 AAGATTGCCACAGTTGTGGAGGG - Intergenic
1189577942 X:42375412-42375434 CAGAGTGCCCCATCTGGGGAGGG - Intergenic
1190310868 X:49116210-49116232 CAGAGTCCCACCGGTCTGGAAGG + Exonic
1191692843 X:63958771-63958793 CAGACTAACACAGGGGTGGAGGG + Intergenic
1193507983 X:82366050-82366072 CACAGTTCCAAAAGTGTGGAGGG + Intergenic
1194138234 X:90174671-90174693 CACAGTGCCAAGAGTGTGGAGGG + Intergenic
1194675472 X:96788942-96788964 CACAGTGCCACAGGTATAGTAGG + Intronic
1195311558 X:103636522-103636544 CTGAGGGCCACATGTATGGATGG + Intergenic
1195681446 X:107549925-107549947 CAGAGAGCCAAAGGTGTAGGAGG - Intronic
1197243128 X:124140992-124141014 CACAGTTCCAAAAGTGTGGAGGG + Intronic
1197752693 X:129976395-129976417 CTTAGAGCCCCAGGTGTGGATGG - Intergenic
1198741365 X:139846872-139846894 CAGAGTGCCACAGGAGTCACTGG - Intronic
1199072829 X:143498509-143498531 CAAAGTTCCACAGGTCTGTAGGG + Intergenic
1200204828 X:154308364-154308386 CAGGGTGCCAGAGCAGTGGAAGG + Intronic
1200484031 Y:3744911-3744933 CACAGTGCCAAGAGTGTGGAGGG + Intergenic