ID: 1028922440

View in Genome Browser
Species Human (GRCh38)
Location 7:96322413-96322435
Sequence AAGTAACGACAGATGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028922438_1028922440 -9 Left 1028922438 7:96322399-96322421 CCGATGGGAGGGGCAAGTAACGA No data
Right 1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG No data
1028922437_1028922440 -2 Left 1028922437 7:96322392-96322414 CCTCGGACCGATGGGAGGGGCAA No data
Right 1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG No data
1028922436_1028922440 -1 Left 1028922436 7:96322391-96322413 CCCTCGGACCGATGGGAGGGGCA No data
Right 1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG No data
1028922430_1028922440 14 Left 1028922430 7:96322376-96322398 CCAGGGGCTACTGGGCCCTCGGA No data
Right 1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028922440 Original CRISPR AAGTAACGACAGATGGTGCA CGG Intergenic
No off target data available for this crispr