ID: 1028929664

View in Genome Browser
Species Human (GRCh38)
Location 7:96398414-96398436
Sequence AGGGAGAATGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028929664_1028929670 16 Left 1028929664 7:96398414-96398436 CCCACAATCACTGCATTCTCCCT No data
Right 1028929670 7:96398453-96398475 TTCCCTCTCTATGTATCACATGG No data
1028929664_1028929675 30 Left 1028929664 7:96398414-96398436 CCCACAATCACTGCATTCTCCCT No data
Right 1028929675 7:96398467-96398489 ATCACATGGCTGCTGCTCAGGGG No data
1028929664_1028929674 29 Left 1028929664 7:96398414-96398436 CCCACAATCACTGCATTCTCCCT No data
Right 1028929674 7:96398466-96398488 TATCACATGGCTGCTGCTCAGGG No data
1028929664_1028929673 28 Left 1028929664 7:96398414-96398436 CCCACAATCACTGCATTCTCCCT No data
Right 1028929673 7:96398465-96398487 GTATCACATGGCTGCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028929664 Original CRISPR AGGGAGAATGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr