ID: 1028930712

View in Genome Browser
Species Human (GRCh38)
Location 7:96409764-96409786
Sequence GAAGCATGGTTGAGAGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028930707_1028930712 1 Left 1028930707 7:96409740-96409762 CCAAATTTAGTTTTCCTGCACAG No data
Right 1028930712 7:96409764-96409786 GAAGCATGGTTGAGAGCTTTTGG No data
1028930705_1028930712 28 Left 1028930705 7:96409713-96409735 CCCAGGCAGGCAAAGATGGCAAG No data
Right 1028930712 7:96409764-96409786 GAAGCATGGTTGAGAGCTTTTGG No data
1028930706_1028930712 27 Left 1028930706 7:96409714-96409736 CCAGGCAGGCAAAGATGGCAAGA No data
Right 1028930712 7:96409764-96409786 GAAGCATGGTTGAGAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028930712 Original CRISPR GAAGCATGGTTGAGAGCTTT TGG Intergenic
No off target data available for this crispr