ID: 1028931386

View in Genome Browser
Species Human (GRCh38)
Location 7:96416266-96416288
Sequence CAGAATGCTCAACCTAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028931386_1028931388 3 Left 1028931386 7:96416266-96416288 CCCTCATTAGGTTGAGCATTCTG No data
Right 1028931388 7:96416292-96416314 CTCAGAGAAGTTCACTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028931386 Original CRISPR CAGAATGCTCAACCTAATGA GGG (reversed) Intergenic
No off target data available for this crispr