ID: 1028934034

View in Genome Browser
Species Human (GRCh38)
Location 7:96445665-96445687
Sequence GTCCTAGACTTTTCTAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028934033_1028934034 -4 Left 1028934033 7:96445646-96445668 CCAGGGCTTGTACTTTTCTGTCC No data
Right 1028934034 7:96445665-96445687 GTCCTAGACTTTTCTAAGAATGG No data
1028934028_1028934034 25 Left 1028934028 7:96445617-96445639 CCATGGCCTGGTGACTGGGCTTC No data
Right 1028934034 7:96445665-96445687 GTCCTAGACTTTTCTAAGAATGG No data
1028934032_1028934034 3 Left 1028934032 7:96445639-96445661 CCAAGATCCAGGGCTTGTACTTT No data
Right 1028934034 7:96445665-96445687 GTCCTAGACTTTTCTAAGAATGG No data
1028934029_1028934034 19 Left 1028934029 7:96445623-96445645 CCTGGTGACTGGGCTTCCAAGAT No data
Right 1028934034 7:96445665-96445687 GTCCTAGACTTTTCTAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028934034 Original CRISPR GTCCTAGACTTTTCTAAGAA TGG Intergenic
No off target data available for this crispr