ID: 1028935010

View in Genome Browser
Species Human (GRCh38)
Location 7:96455034-96455056
Sequence AATTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028935010_1028935014 15 Left 1028935010 7:96455034-96455056 CCTGCCATCTTCTGCAGATAATT No data
Right 1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1028935010_1028935015 16 Left 1028935010 7:96455034-96455056 CCTGCCATCTTCTGCAGATAATT No data
Right 1028935015 7:96455073-96455095 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1028935010_1028935016 22 Left 1028935010 7:96455034-96455056 CCTGCCATCTTCTGCAGATAATT No data
Right 1028935016 7:96455079-96455101 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1028935010_1028935012 4 Left 1028935010 7:96455034-96455056 CCTGCCATCTTCTGCAGATAATT No data
Right 1028935012 7:96455061-96455083 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1028935010_1028935017 25 Left 1028935010 7:96455034-96455056 CCTGCCATCTTCTGCAGATAATT No data
Right 1028935017 7:96455082-96455104 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028935010 Original CRISPR AATTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr