ID: 1028935147

View in Genome Browser
Species Human (GRCh38)
Location 7:96456017-96456039
Sequence TGGTGCCGTATCGAGGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028935147_1028935156 13 Left 1028935147 7:96456017-96456039 CCTGAGCCCTCGATACGGCACCA No data
Right 1028935156 7:96456053-96456075 TCAGCCAGCTACCTGGTGGCAGG 0: 143
1: 211
2: 198
3: 134
4: 353
1028935147_1028935154 6 Left 1028935147 7:96456017-96456039 CCTGAGCCCTCGATACGGCACCA No data
Right 1028935154 7:96456046-96456068 GGGGTGATCAGCCAGCTACCTGG 0: 88
1: 205
2: 207
3: 161
4: 246
1028935147_1028935159 26 Left 1028935147 7:96456017-96456039 CCTGAGCCCTCGATACGGCACCA No data
Right 1028935159 7:96456066-96456088 TGGTGGCAGGTTGATTATACCGG 0: 29
1: 188
2: 212
3: 205
4: 280
1028935147_1028935155 9 Left 1028935147 7:96456017-96456039 CCTGAGCCCTCGATACGGCACCA No data
Right 1028935155 7:96456049-96456071 GTGATCAGCCAGCTACCTGGTGG 0: 165
1: 218
2: 182
3: 147
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028935147 Original CRISPR TGGTGCCGTATCGAGGGCTC AGG (reversed) Intergenic
No off target data available for this crispr