ID: 1028935538

View in Genome Browser
Species Human (GRCh38)
Location 7:96459719-96459741
Sequence TGCTGTGGTGGCCCTCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028935538_1028935545 11 Left 1028935538 7:96459719-96459741 CCCTTGAGAGGGCCACCACAGCA No data
Right 1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG No data
1028935538_1028935546 16 Left 1028935538 7:96459719-96459741 CCCTTGAGAGGGCCACCACAGCA No data
Right 1028935546 7:96459758-96459780 CATCAAATTTCAGTAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028935538 Original CRISPR TGCTGTGGTGGCCCTCTCAA GGG (reversed) Intergenic
No off target data available for this crispr