ID: 1028935539

View in Genome Browser
Species Human (GRCh38)
Location 7:96459720-96459742
Sequence CTGCTGTGGTGGCCCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028935539_1028935546 15 Left 1028935539 7:96459720-96459742 CCTTGAGAGGGCCACCACAGCAG No data
Right 1028935546 7:96459758-96459780 CATCAAATTTCAGTAAGGTGAGG No data
1028935539_1028935545 10 Left 1028935539 7:96459720-96459742 CCTTGAGAGGGCCACCACAGCAG No data
Right 1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028935539 Original CRISPR CTGCTGTGGTGGCCCTCTCA AGG (reversed) Intergenic
No off target data available for this crispr