ID: 1028935543

View in Genome Browser
Species Human (GRCh38)
Location 7:96459734-96459756
Sequence ATCTCCCAAGGCTACTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028935543_1028935545 -4 Left 1028935543 7:96459734-96459756 CCACAGCAGTAGCCTTGGGAGAT No data
Right 1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG No data
1028935543_1028935546 1 Left 1028935543 7:96459734-96459756 CCACAGCAGTAGCCTTGGGAGAT No data
Right 1028935546 7:96459758-96459780 CATCAAATTTCAGTAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028935543 Original CRISPR ATCTCCCAAGGCTACTGCTG TGG (reversed) Intergenic
No off target data available for this crispr