ID: 1028935545

View in Genome Browser
Species Human (GRCh38)
Location 7:96459753-96459775
Sequence AGATGCATCAAATTTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028935538_1028935545 11 Left 1028935538 7:96459719-96459741 CCCTTGAGAGGGCCACCACAGCA No data
Right 1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG No data
1028935542_1028935545 -1 Left 1028935542 7:96459731-96459753 CCACCACAGCAGTAGCCTTGGGA No data
Right 1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG No data
1028935543_1028935545 -4 Left 1028935543 7:96459734-96459756 CCACAGCAGTAGCCTTGGGAGAT No data
Right 1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG No data
1028935539_1028935545 10 Left 1028935539 7:96459720-96459742 CCTTGAGAGGGCCACCACAGCAG No data
Right 1028935545 7:96459753-96459775 AGATGCATCAAATTTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028935545 Original CRISPR AGATGCATCAAATTTCAGTA AGG Intergenic
No off target data available for this crispr