ID: 1028937650

View in Genome Browser
Species Human (GRCh38)
Location 7:96484203-96484225
Sequence ACTCTGTAGGGCATAACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028937650_1028937654 20 Left 1028937650 7:96484203-96484225 CCAGAGGTTATGCCCTACAGAGT 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1028937654 7:96484246-96484268 TACATTCTCCTTCCTGCCTGTGG 0: 1
1: 0
2: 0
3: 34
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028937650 Original CRISPR ACTCTGTAGGGCATAACCTC TGG (reversed) Intronic
904295026 1:29514585-29514607 ATTGTGGAGGGCATACCCTCAGG - Intergenic
905654180 1:39675468-39675490 ACCCTGTAGGGCATGACTCCAGG + Intergenic
908675922 1:66603949-66603971 ACACTGTAGTCCATATCCTCTGG - Intronic
910221160 1:84890664-84890686 ACTCTGTTGGGTATAATCACAGG + Intronic
917238359 1:172919135-172919157 AGTCTTTAGGGCATGCCCTCAGG + Intergenic
920393289 1:205624954-205624976 ATTCTTTAGGGCAGAAACTCTGG + Intronic
924439690 1:244075779-244075801 ACTCTGGAAGGCAGAACCTTAGG + Intergenic
1065150018 10:22813064-22813086 TCTTTGTTGGGAATAACCTCTGG + Intergenic
1070535702 10:77375747-77375769 CCCCTGAAGGGCATGACCTCTGG - Intronic
1080571806 11:33563691-33563713 TCTCTCTTGGGCATAAACTCTGG - Intronic
1094858412 12:34431527-34431549 CCTCTGTAGGGCTCCACCTCTGG + Intergenic
1101509103 12:105376768-105376790 CCTCTGTAGAACATAACCCCAGG - Intronic
1106892587 13:34262137-34262159 AGCCTATAGGGCATAACCTGTGG - Intergenic
1111344399 13:86931115-86931137 ACTCTTTATGGCATTAGCTCAGG + Intergenic
1112090669 13:96079917-96079939 GTTCTGTAGGGCACAAGCTCAGG + Intergenic
1112315405 13:98357903-98357925 ACACTGTAGGGCATAGTCTGGGG + Intronic
1119830067 14:77694153-77694175 ACTCAGTAGTGCATAGTCTCTGG - Intronic
1129751329 15:78066733-78066755 GCTCTGTAAGGCATACCCTCTGG - Intronic
1135780555 16:25296163-25296185 ACTCTGAAGTGCAAAACCACAGG - Intergenic
1135989601 16:27209962-27209984 TCTCTGTTGGGCAGAAGCTCTGG - Intronic
1140375376 16:74441285-74441307 ACTTTGTAAGGGATAACCTTTGG + Intergenic
1140479268 16:75253703-75253725 ACACTGTGGGGCTTAACTTCTGG - Intronic
1148538948 17:48464461-48464483 AATCTGTAGGGGACAAACTCAGG + Intergenic
1150431393 17:65120794-65120816 ACTCTGTAGGGCCAAAACGCTGG - Intergenic
1158078497 18:53560834-53560856 AATCTGTAGGTCAGAACATCAGG - Intergenic
1160590968 18:79944478-79944500 CCTCTGCAGGGCAGAACCACAGG + Intronic
1163683162 19:18695417-18695439 ACTCTGCACGGAATAACCTGTGG - Intronic
925436629 2:3843653-3843675 ACTGTGAAGGGCATGGCCTCTGG + Intronic
932160884 2:69458453-69458475 ACTCTGTAGGGCTCACCCTGAGG - Intronic
934163445 2:89273371-89273393 ACCCTGTAGGGCATAATGGCAGG + Intergenic
934203829 2:89909153-89909175 ACCCTGTAGGGCATAATGGCAGG - Intergenic
936501972 2:113073745-113073767 ACCTTTTAGGGCAGAACCTCTGG - Intronic
938744771 2:134267126-134267148 ACTTGTTAGGGAATAACCTCTGG - Intronic
939298299 2:140298693-140298715 ACTCTGTGGGGACTAACATCAGG + Intronic
939548162 2:143579647-143579669 ACTAAGTGGGGCATAGCCTCTGG - Intronic
939850962 2:147304113-147304135 ACTCCATAAGGCATAATCTCAGG + Intergenic
940683077 2:156810406-156810428 ACTATGTATGGCACAACCTGAGG - Intergenic
941656592 2:168151099-168151121 ACTCTCTAGGGCCTAGACTCAGG - Intronic
1173596465 20:44261760-44261782 AGTCTGTAGGGCGTAAACTGGGG + Intronic
949585857 3:5436145-5436167 CCTCTGTGGGGCAGAATCTCAGG + Intergenic
952974043 3:38679085-38679107 AATCTGTAGGGGACTACCTCAGG + Intergenic
954445447 3:50543891-50543913 ACTCAGTCAAGCATAACCTCTGG + Intergenic
956953125 3:74305399-74305421 ATTCTGTAGGGCATATACTTAGG - Intronic
957641783 3:82862466-82862488 ATTCTGTTTGGCTTAACCTCAGG - Intergenic
958475268 3:94572782-94572804 CCACTGTAGAGCATAACCACAGG + Intergenic
959914588 3:111802296-111802318 ACTCTGTAGGCCAGATCCTCTGG - Intronic
968445146 4:648667-648689 GCTCTGTAGGGCCTAACCCATGG - Intronic
969540758 4:7787647-7787669 ACACTGTTGGGCCTCACCTCTGG - Intronic
972085751 4:35212541-35212563 ACTCTGGAGAGCATTACCTTGGG + Intergenic
973016474 4:45145408-45145430 ACATTATAGGGTATAACCTCAGG + Intergenic
974078478 4:57189573-57189595 AGGCTTTAGGGCATAGCCTCAGG + Intergenic
974495773 4:62624651-62624673 ACTCTGTACTGTAAAACCTCTGG - Intergenic
977928318 4:102726303-102726325 ACTACATAGGGCATAACCACTGG + Intronic
978279496 4:106993143-106993165 ACTGTTCAGAGCATAACCTCTGG + Intronic
980478700 4:133356566-133356588 ACTCAGTAGGGCATGACCTCAGG + Intergenic
980681865 4:136172904-136172926 ACTCTGGAGAGCATAACCTGCGG - Intergenic
983060226 4:163152355-163152377 ACTCTTTAGAGCAGAACATCAGG - Intronic
988938083 5:36110385-36110407 AGTCTGTAGGGCATATCCTGGGG - Intronic
989775733 5:45205265-45205287 ATTCTGTAGGTCAGAACCACTGG + Intergenic
994867505 5:105295211-105295233 AGACTGTAGGGCATGATCTCAGG - Intergenic
997198318 5:131994342-131994364 ACACTGTAGGGCAGGCCCTCGGG + Intronic
1003326063 6:5091972-5091994 ACTCTGTGGGAAATGACCTCAGG - Intergenic
1003630707 6:7783930-7783952 ACTCTGTAGGGCTCATCCTGAGG - Intronic
1003742061 6:8951987-8952009 ATTCTATAGTGCATAACCCCAGG - Intergenic
1003785016 6:9475757-9475779 TCTGGGTAGGGCATGACCTCAGG + Intergenic
1006934763 6:37709765-37709787 ACAGTGTAGGGCATGCCCTCTGG - Intergenic
1011853554 6:91660559-91660581 ACCCCTTAGGGCATACCCTCAGG - Intergenic
1017020603 6:150137043-150137065 ACTCTGGAGGGCATTTCCTAAGG + Intergenic
1019459546 7:1149660-1149682 AGGCTGTAGGGCATAGCCTGTGG + Intergenic
1022945239 7:35277592-35277614 ACTCTATAAGGCATGCCCTCTGG + Intergenic
1028937650 7:96484203-96484225 ACTCTGTAGGGCATAACCTCTGG - Intronic
1031625578 7:123989007-123989029 TCTATGTAGGGCATAAGATCTGG - Intergenic
1033639617 7:143248970-143248992 TATCTGTAGAGCATAGCCTCTGG + Intronic
1034745301 7:153518664-153518686 TCCTTGTAGGGCATAAGCTCTGG + Intergenic
1039217327 8:35286774-35286796 TGTCTATAGGGCATATCCTCTGG + Intronic
1039862452 8:41470655-41470677 ACACTCTTGGGCATAACGTCAGG - Intergenic
1040703285 8:50093575-50093597 ACTCTGTAGGAAAGAACTTCAGG - Intronic
1041448536 8:57981453-57981475 AATACGTAGGGCATAAACTCTGG - Intergenic
1042154031 8:65822064-65822086 AATCTGTGGGACATAACCCCAGG - Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1057275538 9:93674311-93674333 ACACTGTAGGGCATGACCTGTGG - Intronic
1058476696 9:105341950-105341972 TCTCTGTAGGGCATAAGTTTTGG - Intronic
1060640375 9:125233162-125233184 ACTCTGTAGGGGATGACATCAGG + Intronic
1061760428 9:132847399-132847421 ACTATGTAGTTCATATCCTCAGG - Intronic
1061840201 9:133354266-133354288 TCTCTGTAGGGCATATTCTAGGG + Intronic
1190024484 X:46911617-46911639 AATCTGTAGGGCATACAGTCAGG + Intergenic
1196742386 X:119036687-119036709 ACACTGTAGGGCATATCCCTGGG + Intergenic