ID: 1028939378

View in Genome Browser
Species Human (GRCh38)
Location 7:96503846-96503868
Sequence TTCTTCAGCTAGAAGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028939378 Original CRISPR TTCTTCAGCTAGAAGAGTAA GGG Intronic
902750755 1:18508804-18508826 TTCTTCAGGCAGAAGAAAAATGG - Intergenic
903634915 1:24805909-24805931 TTCTTCATCTAGAAAAAAAATGG + Intronic
904395913 1:30222006-30222028 CTCTTCAGCCAGAAGGGTAGGGG + Intergenic
905479184 1:38249546-38249568 ATCTTATGCTAGAAGAGAAATGG + Intergenic
907807062 1:57831327-57831349 ATATACAGCTAGACGAGTAAGGG - Intronic
908132978 1:61094849-61094871 TTATTTAGCTAGAACACTAACGG - Intronic
908626620 1:66051517-66051539 TTTTTCAGCGAGAGGAATAAAGG - Intronic
910794744 1:91086438-91086460 GTCTTAACCTAAAAGAGTAAAGG + Intergenic
911195827 1:94994421-94994443 TCCTTCAGCTTGAGGAGTAAGGG + Intronic
911848620 1:102785564-102785586 TTCTAAAGCAAGAAGAGAAAAGG - Intergenic
912461568 1:109836078-109836100 GTCTTAACCTAAAAGAGTAATGG + Intergenic
915103959 1:153520821-153520843 TTATTTAGCTAACAGAGTAAGGG - Intergenic
916547183 1:165816948-165816970 TTCTTCTACTAGAAGAGATAAGG - Intronic
918827877 1:189350226-189350248 TTCTTCATTTAAAAGAGAAATGG + Intergenic
922021757 1:221712257-221712279 TTCTTTCCCAAGAAGAGTAAAGG + Intronic
922446439 1:225701844-225701866 TTCTTCAGCTCTAAGATGAAGGG + Intergenic
923560105 1:235032728-235032750 TTCTTCAGAAAGAAGAAAAACGG + Intergenic
924071005 1:240278537-240278559 TTCCTCAGCTAGAAGAGACGAGG + Intronic
924260937 1:242230583-242230605 TTCATTGGCTAGAAGACTAACGG + Intronic
1063422376 10:5923667-5923689 TTCTTCAGCCAGAGGAAGAACGG + Exonic
1064321522 10:14309867-14309889 TTCTTCAGCTTTAAATGTAAAGG + Intronic
1064539443 10:16390513-16390535 TTCTTCAGCTACAATTGTAGTGG - Intergenic
1068198775 10:53754828-53754850 TTATTAAGCTGAAAGAGTAATGG + Intergenic
1069316878 10:67115619-67115641 TTCTTCATCTACTAGAGGAATGG + Intronic
1073726899 10:106243057-106243079 TTGTTAAGCTAGGAGAGTAAGGG + Intergenic
1075001138 10:118798967-118798989 TTGTTCAGCAAGCAGAGTACTGG - Intergenic
1077791800 11:5449152-5449174 TTTTTCAGCTAAAAGAGCACAGG + Intronic
1078751406 11:14167920-14167942 GTCTTAACCTAAAAGAGTAATGG - Intronic
1081049722 11:38323449-38323471 TTCTACAGCTTGAAGTGTTAGGG + Intergenic
1081464158 11:43300878-43300900 TTCTGTAGCTAGGACAGTAATGG + Intergenic
1084582780 11:70034523-70034545 TTATTCATCTAGAAGAGAAGAGG + Intergenic
1085195380 11:74668636-74668658 TTCTTAAGCTGGGTGAGTAAGGG + Intronic
1085730086 11:78990189-78990211 TTCTTCAGCTATAAAATTATGGG - Intronic
1086736612 11:90314495-90314517 TTATTCAGCTATAAAAATAATGG - Intergenic
1086821047 11:91436524-91436546 TTCTACAGCTGGAAAAGTGATGG - Intergenic
1087278982 11:96188977-96188999 TTGTTCAGTTAAAAGAGTAATGG - Intronic
1087662640 11:101005014-101005036 TTTTTGAGGAAGAAGAGTAATGG + Intergenic
1087848106 11:102996121-102996143 TTCTTCATCTAGAAAACGAAGGG + Intergenic
1088293685 11:108268413-108268435 TTCTTCAGCTAAAGGATTAATGG - Exonic
1090237082 11:125156997-125157019 TTCTCCAGCTATTAGAGTTAGGG - Intergenic
1090795684 11:130133957-130133979 TTCTTCCGCTAACAGAGTGAAGG - Intronic
1090862244 11:130664522-130664544 TTAATCAGCTAGAAGAGCAGGGG + Intergenic
1093101313 12:15032961-15032983 GTCTTAATCTAAAAGAGTAATGG - Intergenic
1093438363 12:19163975-19163997 TTCTTGAGAGAGAAGAATAATGG - Intronic
1094107279 12:26827542-26827564 TTTTTCAGCTGGAAAAGTCATGG - Intronic
1096386908 12:51200114-51200136 TTCTTCAGCTAGATGTGAGAAGG - Intronic
1096752610 12:53771598-53771620 CTCTTCAGGTAGAAAAATAATGG - Intergenic
1098423636 12:70333433-70333455 TGCTTCAGATAGAAGAGAACAGG + Intronic
1098721135 12:73899456-73899478 TGCTTCAGCTGGAATAGCAAGGG + Intergenic
1098759404 12:74404099-74404121 TAATTCAAATAGAAGAGTAAAGG - Intergenic
1100294847 12:93251205-93251227 GTCTTAACCTAGAAGAGTAATGG - Intergenic
1101672826 12:106892576-106892598 TTTCTCAGCTAGAAGAGTCCTGG - Intergenic
1102358352 12:112260239-112260261 GTCCTCTGCTAGAAGAGTTAAGG + Intronic
1106359561 13:29018183-29018205 TACTTTAAGTAGAAGAGTAAAGG + Intronic
1106848464 13:33762789-33762811 TTCTTTGGCTAGAAAAGAAAAGG + Intergenic
1107378676 13:39832281-39832303 TTTTTCAGCTAGCTGATTAATGG - Intergenic
1108488214 13:50950215-50950237 TTCTTCAGCCAGCAAAGTAACGG + Intronic
1108771461 13:53706494-53706516 TTCACCAGCTATAAAAGTAAAGG - Intergenic
1110675060 13:78232768-78232790 TTTTTCAGATAGAGGAGAAATGG - Intergenic
1110727841 13:78846373-78846395 TGCATGAGCTAGAAGAATAAGGG - Intergenic
1113700687 13:112385218-112385240 GTCTTAACCTAAAAGAGTAATGG - Intronic
1114443455 14:22769728-22769750 TTCTGCAGCTAGAAGGTTGAAGG - Intronic
1115762754 14:36591574-36591596 TTCTTCTCCTAACAGAGTAAGGG + Intergenic
1116278948 14:42876577-42876599 TTCTTCAGATAGAAGATTCATGG + Intergenic
1119661169 14:76452799-76452821 TTCGTCAGCTGGGAGAGTCAGGG + Intronic
1119847779 14:77843385-77843407 TTCAGCGGCTAGAAGAGTGAGGG - Intronic
1120017152 14:79487015-79487037 CTCTTCAGCAAGAAGAGCAAAGG + Intronic
1121155809 14:91682832-91682854 TTCTTCAGTAAGAAGAGTGATGG - Intronic
1122236042 14:100331117-100331139 TTCTTCTGCTCCCAGAGTAAGGG + Intergenic
1125259837 15:37810638-37810660 TTGTACAACTTGAAGAGTAAAGG + Intergenic
1125404003 15:39334303-39334325 TTCTTGAGCTAGAAGGCTATGGG - Intergenic
1126194586 15:45917988-45918010 TCCTTCACCTGGAAGAGCAAAGG + Intergenic
1126918145 15:53489096-53489118 TTCTTTAGTAAGAAGAGTAGGGG + Intergenic
1128351290 15:66891682-66891704 GTCTTAACCTAAAAGAGTAATGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128823471 15:70685106-70685128 GTCTTCAGGTAGAAGAATCAAGG - Intronic
1129576846 15:76758530-76758552 ATCTTGAGCAAGAAGAGCAAAGG - Intronic
1130837587 15:87665991-87666013 GTCCTAACCTAGAAGAGTAATGG + Intergenic
1130999376 15:88926428-88926450 GTCTTAACCTAAAAGAGTAATGG + Intergenic
1131758398 15:95592123-95592145 TTCTTGAGCCAGAAGAGACAGGG - Intergenic
1131845020 15:96481993-96482015 TTCTTCAGGCAGAAGGGAAATGG - Intergenic
1131914509 15:97250191-97250213 GTCTTAACCTAAAAGAGTAACGG - Intergenic
1132401687 15:101512246-101512268 TTCTTCATCTAGAAGATTTGCGG + Intronic
1137923731 16:52519292-52519314 TTCTTAAACTAGAAATGTAAGGG + Intronic
1138431300 16:56970916-56970938 TTCCTGAGCTACAAGAGTCAGGG + Intronic
1138571837 16:57879348-57879370 TACTCCAGCTATCAGAGTAAGGG + Intergenic
1138762928 16:59565695-59565717 TTCTTCACAGAGAAGAGAAAGGG - Intergenic
1138780694 16:59781526-59781548 TTCTGCAGCTTGAATAGTCATGG - Intergenic
1141506247 16:84480430-84480452 ATCTGCAGACAGAAGAGTAAAGG + Intronic
1142795744 17:2305286-2305308 TTTTTCAGCTGGAAAAATAATGG + Intronic
1142822305 17:2479879-2479901 TTCTCCACCTATAAAAGTAAAGG + Intronic
1144204629 17:12971364-12971386 TTTTTCAAGTAGAAGAGAAAGGG + Intronic
1144224453 17:13131440-13131462 TTCTTCAGCTGGTAGCATAAGGG + Intergenic
1144280403 17:13720556-13720578 ATCCTCAGGTAGGAGAGTAAGGG - Intergenic
1146471315 17:33127178-33127200 TTCTCTAGCAACAAGAGTAATGG - Intronic
1146568079 17:33930480-33930502 TGCTTCAGGTAGTAGAATAAGGG + Intronic
1147282234 17:39371457-39371479 TTCTACAGCTAGATGAGGGAAGG + Intronic
1149167239 17:53767103-53767125 ATCTTCAGCTAGGAGAGTGGTGG - Intergenic
1150195140 17:63290140-63290162 TTCTTCTGCTAGAAGCTTGAGGG + Intronic
1154054386 18:10998245-10998267 TTCTTCAGCCTGAAGGGAAATGG + Intronic
1155974002 18:32108706-32108728 TTGCTCAGGTAGAAGGGTAATGG + Intronic
1158873904 18:61714430-61714452 TTCCTCAGTTAGGAGGGTAAGGG - Intergenic
1164200109 19:23011053-23011075 TCCTTGAGGTAGAACAGTAAAGG + Intergenic
925092810 2:1168810-1168832 TTCTTGAGGAAAAAGAGTAAGGG + Intronic
925532143 2:4875886-4875908 TTGTCCAGCTGGTAGAGTAATGG - Intergenic
927270494 2:21204374-21204396 TTCTTTAACAAAAAGAGTAAGGG + Intergenic
928142363 2:28740760-28740782 TGATTCAGCTAGAAGAGATAGGG - Intergenic
928672412 2:33615276-33615298 TTCTTACCCTAAAAGAGTAATGG + Intergenic
929828979 2:45332304-45332326 TTCTTCAGCAAGCATAGAAAGGG + Intergenic
933625969 2:84599434-84599456 TTCTTCTGTTAGAAGTTTAAAGG + Intronic
935272674 2:101448640-101448662 CTCTTCAGCTATCAGAGAAAAGG + Intronic
939705764 2:145450948-145450970 TTCTTCAGGTGGCAGAGGAAGGG - Intergenic
941142369 2:161800993-161801015 TGTTTCAGCTAGGAAAGTAAAGG + Intronic
941294636 2:163721132-163721154 TTCTTCTACCAGAAGGGTAAAGG + Intronic
941545315 2:166842834-166842856 CTCTTCATCTTGAAGAGTCAGGG + Intergenic
941877635 2:170451017-170451039 GTCTTAAACTAAAAGAGTAAAGG - Intronic
943445046 2:187974269-187974291 TTCTTCATCTAGAAGAGGGTGGG + Intergenic
947509446 2:230737623-230737645 TTCTTCTGCCAAAATAGTAAAGG + Intronic
1169162974 20:3398105-3398127 CTCTAAAGCTAGAAGAGAAATGG + Intronic
1169918280 20:10705744-10705766 TGCTCCAGGCAGAAGAGTAAGGG + Intergenic
1171310270 20:24139855-24139877 GTCTTGAGCTAGAAGAGGCAAGG + Intergenic
1173701390 20:45075003-45075025 CTCTTAAGCTAGAAGAGAAGTGG - Exonic
1173772451 20:45673666-45673688 TTCTTCAGCTCCTAGAGCAAGGG - Intergenic
1174514969 20:51084661-51084683 TTCTTTACCTAGAAGTGGAAGGG - Intergenic
1175555661 20:59854030-59854052 TTATTCAGCTATAAAAGGAAAGG - Intergenic
1175767911 20:61603772-61603794 TTCTCCAGGTAGAATAGGAAAGG + Intronic
1178638246 21:34323993-34324015 TTCTGAAGCTAGAAGAGGCAAGG + Intergenic
1178955285 21:37016421-37016443 TTTTTCAGATAGAAGAGAAAAGG - Intronic
1179327999 21:40368730-40368752 TTCTTCAGCTACAAAGGCAAAGG + Intronic
1179385205 21:40934749-40934771 TTCTTCAGCTAGGAGTTTGAAGG - Intergenic
1180705436 22:17807202-17807224 ATCTTCTGCAAGAAGAGAAATGG + Intronic
1181960945 22:26621486-26621508 TGCTTCAACTGGAAGAGAAAGGG + Intergenic
1183536094 22:38402286-38402308 TGCTTCAGCCAGAAGGGGAAGGG - Intergenic
1184275631 22:43408036-43408058 TTCCTCAGCTCGAGGAGAAAGGG - Intergenic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
949928600 3:9060810-9060832 TCCATCTGCTAGATGAGTAAGGG + Intronic
949998300 3:9636475-9636497 GTCTTAACCTAAAAGAGTAATGG - Intergenic
950697888 3:14717704-14717726 TTCTTCAGGCTGAAGAGAAATGG - Intronic
950892826 3:16419843-16419865 GTCTTCTGCTAGAAGGGGAAGGG - Intronic
951853055 3:27164364-27164386 AGCTTCATCTAGAAGGGTAAGGG - Intronic
952166993 3:30760913-30760935 TGCTTCAACTAGAAAATTAAAGG + Intronic
955178782 3:56645839-56645861 TTCTTCAACTATAAAAATAAAGG + Intronic
955254955 3:57321635-57321657 TTATCCACCCAGAAGAGTAAAGG - Intronic
956062909 3:65366332-65366354 TGCCTTAGCTAGAAGAATAATGG - Intronic
956454748 3:69409537-69409559 TTTCTCAGCTAGAAGAATGAGGG - Intronic
956820789 3:72952379-72952401 TTCTTCACCTACTAGAGAAATGG - Intronic
957223268 3:77411594-77411616 TTATTAAGCAAGAAGAATAAAGG + Intronic
957532847 3:81462607-81462629 TTCTTCATCTATAAAATTAAAGG + Intergenic
957836697 3:85603072-85603094 TTTATCAGCTAGTAGAGAAAGGG - Intronic
957983869 3:87547382-87547404 TTCTTATGCCAGAAGAGCAAAGG + Intergenic
958477049 3:94597919-94597941 TTATTGAGCTAGAAGAGAGAGGG - Intergenic
958968364 3:100584355-100584377 GTCTTAAACTATAAGAGTAATGG - Intergenic
959791053 3:110361912-110361934 CTCTTCTGCTGGAAGAGAAATGG - Intergenic
961069100 3:123904858-123904880 TCCTTCACACAGAAGAGTAAAGG + Intronic
962511976 3:136111099-136111121 TTCTTCAGCAAGAAGGTAAATGG + Intronic
963572969 3:147020579-147020601 TTCTTCAGCTAGAAGTGCAGTGG - Intergenic
963976151 3:151482382-151482404 TTCTTCAGCTCCAAGATTAGTGG - Intergenic
964271065 3:154957489-154957511 TTCTTCAGATAGAAAAAAAATGG - Intergenic
964491179 3:157238012-157238034 TGCTGCATCAAGAAGAGTAATGG + Intergenic
964970149 3:162550233-162550255 GTCTTAACCTAAAAGAGTAATGG - Intergenic
965033159 3:163400361-163400383 TTCTACAGCTTGAAAAATAATGG - Intergenic
966797264 3:183727507-183727529 TTCATGAGCTGGAAGAGTAAAGG + Intronic
966824619 3:183953242-183953264 TTGTGCAGCTGGAAGAGAAAGGG - Exonic
966935213 3:184703226-184703248 GTCTTAACCTAGAAGAGTAACGG - Intergenic
967651966 3:191996720-191996742 TTCTTCAGCAAAAAGAAAAATGG + Intergenic
969555139 4:7902834-7902856 TTGTACAGATAGAAAAGTAAAGG - Intronic
970767361 4:19566006-19566028 ATCTGCAGGTAGAAAAGTAATGG + Intergenic
971139376 4:23907113-23907135 TTCTGGAGCTAGAAGAACAAAGG + Intergenic
971241401 4:24892213-24892235 TCCTTCAGCTAGAAGTGGTAGGG - Intronic
971879322 4:32349368-32349390 TGTTTTAGGTAGAAGAGTAAAGG - Intergenic
971931767 4:33093067-33093089 TCCTTAACCTAGAAGAATAAAGG + Intergenic
974018209 4:56669055-56669077 TTCTTAATCTAGAAAAGTGAAGG + Intronic
975411118 4:74051428-74051450 TTCTAAAGCTAGAAGTGAAAGGG - Intergenic
975414575 4:74092149-74092171 TTCCTCAGTTAGGAGGGTAAGGG - Intergenic
976356314 4:84121661-84121683 TTCCCCAGCTATAAGACTAAGGG - Intergenic
977527320 4:98160967-98160989 GTCTTAACCTAAAAGAGTAATGG + Intergenic
978054131 4:104241956-104241978 TTATTGTTCTAGAAGAGTAAGGG + Intergenic
978073566 4:104500518-104500540 CTCTTCAGATAGATAAGTAATGG + Intergenic
978282483 4:107035326-107035348 TTCTTCAGACAGAAGAGGCAGGG - Intronic
979000444 4:115210615-115210637 TTCTTCAGGAAAAAGAGTAATGG - Intergenic
979819621 4:125154568-125154590 TTGTTCAGGTAGAAGGATAAAGG + Intergenic
981679335 4:147377100-147377122 TTCTTCAGAGAAAAGAGTAAAGG + Intergenic
982149449 4:152436593-152436615 CTGTCCAGCTAGAAGAGTCATGG - Intronic
982916059 4:161210916-161210938 ATCTTGAGCAAGAAGAATAATGG - Intergenic
982929086 4:161379050-161379072 TTCTCCGGACAGAAGAGTAAGGG + Intergenic
983018934 4:162650870-162650892 TTCTTCAGCAAAAACATTAAAGG + Intergenic
983165757 4:164475738-164475760 TTCTTCAGTCAGAAAAGAAAAGG - Intergenic
983426992 4:167597809-167597831 TTATTCAGATAGAAGAACAAAGG + Intergenic
983524360 4:168745487-168745509 TTCTTCAACTGGAATAGTTAGGG + Intronic
983574529 4:169246920-169246942 CTCTTCATCTAAAAGAGGAAGGG + Intronic
983869192 4:172805102-172805124 TTCCTCAGCTATAAGATGAAGGG - Intronic
985049047 4:185971500-185971522 TGCTTCAGTTAGAAGAGCCATGG + Intergenic
986295935 5:6438625-6438647 TCCTTCAGCTAGAAGAGCTTTGG - Intergenic
986431957 5:7690445-7690467 TTCTTCAGTATGAAGAATAAAGG - Intronic
987716868 5:21583030-21583052 TTCTTCAGGTAACAGAGAAAGGG + Intergenic
988277714 5:29104064-29104086 TGCTTCTGCTGGATGAGTAAAGG - Intergenic
989490963 5:42052711-42052733 TTTTTCACCTAGAAGAAAAAGGG - Intergenic
989621569 5:43389636-43389658 GTCTTAAGCCAGAAGAGTACCGG + Intronic
989743938 5:44805792-44805814 TTCTGCACCTAGAACAGTATTGG + Intergenic
989814199 5:45716049-45716071 TTTTTCACCTAGAAGAGAAAGGG - Intergenic
990672803 5:58151405-58151427 TTCTTGATCAAGAGGAGTAATGG + Intergenic
991296744 5:65089650-65089672 TACTGCATCTAGAAGAGAAAAGG + Intergenic
993007691 5:82446061-82446083 TTCCTGAGATAGGAGAGTAAAGG + Intergenic
993168468 5:84385051-84385073 TCCTTCTGCTATAAGAGAAAAGG + Intergenic
994635283 5:102338893-102338915 TTCCTCAGTTAGGAGGGTAAGGG + Intergenic
997166375 5:131663986-131664008 GTCTTAACCTAAAAGAGTAATGG + Intronic
998503467 5:142653369-142653391 TCCTTCAGGCAGAAGAGGAAAGG + Intronic
998528683 5:142865312-142865334 TTCTTCATCTAGAAGAGGTCAGG + Intronic
1000496615 5:161991992-161992014 TACTTCAGATTGAATAGTAATGG - Intergenic
1002834797 6:856884-856906 TTCTTCAGCTAGAAGATTTTAGG - Intergenic
1003766880 6:9247510-9247532 TTCTTCAACCAGTAGAGTATAGG + Intergenic
1003813103 6:9806229-9806251 TACTTCAGCAAGAAGAAAAATGG + Intronic
1004625600 6:17373785-17373807 TTCATTAGCTAGAAGGATAAAGG + Intergenic
1004989574 6:21122389-21122411 TTTCTCAGCTATAAGAGTATGGG + Intronic
1005851577 6:29827377-29827399 TTTTTCTTCTAGAAGAGTACAGG + Intronic
1008448174 6:51618027-51618049 TTCTTCAGTTTGAAAAGAAATGG + Exonic
1008768214 6:54946027-54946049 TACTTCAGTTAGAATAGTAAGGG + Intergenic
1009816255 6:68739494-68739516 TTCTTCAGATAGCAGAATGAAGG + Intronic
1010632121 6:78210255-78210277 TTCTCCTGCTAGAAGCATAAAGG + Intergenic
1012750708 6:103159824-103159846 TTCTTTAGCTAGCAGAGTGTGGG - Intergenic
1013705195 6:112824956-112824978 TTCTTCAGGTAATACAGTAAAGG - Intergenic
1014623272 6:123695694-123695716 TTCTTCAGCTTGAAGATCTAAGG - Intergenic
1015352713 6:132241527-132241549 TACTTCTGCTTGAAGAGGAAAGG + Intergenic
1020371055 7:7432372-7432394 TTTATCAGCTAGAAGAGTAGAGG - Intronic
1020968111 7:14898574-14898596 TTTTTAAACTAGAAGAGGAAGGG + Intronic
1022020063 7:26390433-26390455 TTCTTTAGCAAGAAGATAAAGGG - Intergenic
1022622463 7:31999068-31999090 GTCTTCAGGAAGATGAGTAAGGG - Intronic
1022775160 7:33519685-33519707 TTCTTCCCCTAGAAGATTCATGG - Intronic
1023568424 7:41548165-41548187 TTCCTCAGTTAGGAGGGTAAGGG + Intergenic
1024582223 7:50809498-50809520 TTCCTAGGCTTGAAGAGTAATGG + Intergenic
1024784396 7:52890256-52890278 ATATTCAGATAGAAGAGTGAGGG - Intergenic
1026490826 7:70861864-70861886 GACTTCAGCTTGAAGATTAAGGG - Intergenic
1027833678 7:83214278-83214300 TTCTTCAATTATTAGAGTAAAGG - Intergenic
1028701194 7:93782568-93782590 TTCTTCAGTTAGAAGACAAATGG - Intronic
1028939378 7:96503846-96503868 TTCTTCAGCTAGAAGAGTAAGGG + Intronic
1030081979 7:105786177-105786199 TTGTTCAGCAAGAAGCTTAACGG + Intronic
1030139482 7:106290397-106290419 TTCTTGATCTAGAAGAGTCCAGG - Intergenic
1034344535 7:150378529-150378551 TTCCTCAGCTAGAAAACAAAGGG + Intronic
1037046219 8:14307525-14307547 TTCTTCAGCAAAAAAAGAAAGGG + Intronic
1040727471 8:50399572-50399594 TTTTTCACCCAGAAGTGTAATGG - Intronic
1041100722 8:54394300-54394322 TTTATCAGATAGAAGAGAAATGG + Intergenic
1041149108 8:54913275-54913297 TTCAGCAGCGAGAAGAGTGAAGG - Intergenic
1043319386 8:78963539-78963561 TTCTTGATCTACAAGAATAATGG + Intergenic
1043363982 8:79510238-79510260 TTCTTCAACTGGGAGAGAAAGGG - Intergenic
1044828959 8:96226422-96226444 TTCCTCAGCTAGAAAATGAAGGG - Intronic
1045585493 8:103529957-103529979 TTCTTCAGTTAGAAGGAAAATGG + Intronic
1045842280 8:106594197-106594219 TTCTCCAGCTAGCAGTGTAAAGG + Intronic
1047890942 8:129308870-129308892 TCCTTCAGGTAGAAGAAAAATGG - Intergenic
1049861814 8:144903787-144903809 TCCTTCAGCTCCAAGACTAAAGG + Intergenic
1050046921 9:1556443-1556465 CTTTTCATCTAGAAAAGTAAAGG - Intergenic
1050389753 9:5128869-5128891 TTCTTCAGAAACAAGGGTAAAGG + Intergenic
1051021428 9:12548369-12548391 TTCTTCAGGTAGAAGGCTATAGG - Intergenic
1051938623 9:22475613-22475635 CTCTTCAGCTAGTAGAATAATGG + Intergenic
1052327266 9:27228581-27228603 TTCTTCATCTATAAAATTAAAGG - Intronic
1052898079 9:33766970-33766992 TTTTTTAAGTAGAAGAGTAATGG + Intronic
1054923061 9:70561056-70561078 TTCTTCAGACAGGAGAGGAAGGG - Intronic
1056499498 9:87194306-87194328 ATCTTTAGCTAGAAAAGCAAAGG - Intergenic
1057815373 9:98290353-98290375 TTCTTCACAAAGAAGAGGAACGG - Exonic
1058791550 9:108451376-108451398 TTATACAGATAAAAGAGTAATGG - Intergenic
1061044385 9:128156940-128156962 TTCCTCAGGTAGAACAGTGAGGG + Intergenic
1061830462 9:133289928-133289950 ATCTTAACCTAAAAGAGTAATGG - Intergenic
1185937685 X:4277295-4277317 TTCTCCAGCTAGAACACTAGAGG + Intergenic
1186658957 X:11648505-11648527 TGCTTCAGCGGGAAGAGGAAAGG - Intronic
1187234695 X:17456281-17456303 TTGTTCATCTAGAAGAGTCTGGG + Intronic
1187320281 X:18231668-18231690 GTCTTCACCTAAAAGAGTAGAGG + Intergenic
1187856240 X:23638155-23638177 TTCTCCATCTAGAGGAGAAAAGG + Intergenic
1188606733 X:32040657-32040679 TTCATCAGCAAGAAGGGCAAAGG + Intronic
1188686886 X:33080348-33080370 GTCTTAAACTAAAAGAGTAACGG - Intronic
1192362952 X:70450624-70450646 TTGTTCACCTAGAAGAGGAGAGG - Exonic
1192837897 X:74821516-74821538 TTGTTCATCTATAGGAGTAATGG - Intronic
1192867817 X:75154332-75154354 TTCTTAAGCTGGAAGAATGAGGG - Intronic
1193360035 X:80571020-80571042 TTCTTCATCTTGACGTGTAATGG - Intergenic
1193562842 X:83040815-83040837 TTCATCACTTATAAGAGTAAGGG + Intergenic
1193618653 X:83722783-83722805 TGCTTCAGCTCTTAGAGTAAAGG + Intergenic
1194860512 X:98992701-98992723 TACTTGAGCTAGAATAATAATGG - Intergenic
1194869008 X:99104305-99104327 TCCTTTAGGTAGAATAGTAATGG + Intergenic
1195722232 X:107878114-107878136 CTCCTCAGCCAGAGGAGTAAAGG + Intronic
1196975629 X:121154834-121154856 TTCCTCAGTTAGGAGGGTAAGGG - Intergenic
1199740245 X:150728884-150728906 TTCATGATCTGGAAGAGTAAAGG - Intronic
1201749458 Y:17416839-17416861 GTCTTAACCTAAAAGAGTAACGG + Intergenic