ID: 1028942332

View in Genome Browser
Species Human (GRCh38)
Location 7:96536318-96536340
Sequence GTTCTCTGTGGCCCAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028942332 Original CRISPR GTTCTCTGTGGCCCAAAATG TGG Intronic
901000149 1:6144963-6144985 TTTCTCTCTGCCCCAAAGTGGGG - Intronic
901114360 1:6829772-6829794 TTGCTCTGTGGGACAAAATGAGG - Intronic
902621765 1:17654902-17654924 GTTTTCTGTTGCCCCAGATGAGG - Intronic
903980727 1:27186052-27186074 GTTCTCTTTAGCCCACTATGTGG - Intergenic
906424537 1:45699311-45699333 TTTCTCTGTGGCTCAAACTATGG + Exonic
906696628 1:47827761-47827783 GTCCACTTTGGCCCACAATGAGG + Intronic
906696643 1:47827826-47827848 GTCCACTTTGGCCCACAATGAGG + Intronic
907393673 1:54175044-54175066 CTTCCCTGTGGCACACAATGAGG + Intronic
908732641 1:67242185-67242207 GTTCTCTTTAGCCCATGATGTGG + Intronic
909213671 1:72857586-72857608 GTGCTTTATGGCCCAGAATGTGG + Intergenic
911635967 1:100236862-100236884 GTTCTCTATAGCCGAAGATGCGG + Intronic
914391101 1:147224064-147224086 CTGCCCTGTGTCCCAAAATGGGG + Intronic
915377728 1:155412208-155412230 GTGCTCTGTTGCCCAAGCTGGGG - Intronic
916640550 1:166724367-166724389 GTTCTCTTTAACCCATAATGTGG - Intergenic
917520048 1:175740779-175740801 GTCCTCTGTGGCTCTGAATGTGG - Intronic
918529069 1:185497362-185497384 CCTCTCTGTGCCCCAAAATTGGG - Intergenic
918760496 1:188398498-188398520 TTATTTTGTGGCCCAAAATGAGG - Intergenic
919103159 1:193118541-193118563 GTCTTCTATGGCCCAAAATGTGG - Intergenic
922195913 1:223360421-223360443 GGTCTCAGTGGCCCCAAATGAGG + Intronic
922359360 1:224807425-224807447 GTTCCCACTGGCCCAATATGGGG - Intergenic
923023208 1:230182633-230182655 ATGCTTTGTGGCCCAGAATGTGG + Intronic
1063196359 10:3747317-3747339 GTTCTCTGTTTCTCAAACTGGGG + Intergenic
1065181055 10:23126162-23126184 GTGTTTTGTGGCCCAAAATATGG + Intergenic
1065233367 10:23621726-23621748 GACCTGTGTGGCCCAAAGTGTGG + Intergenic
1067291645 10:44947909-44947931 TGTCTCTGTTGGCCAAAATGGGG + Intergenic
1068803005 10:61162971-61162993 CTACTCTGTGGCCCTGAATGTGG - Intergenic
1070508063 10:77133837-77133859 TTTCTTTGTGGCCTAATATGTGG - Intronic
1071271955 10:84016150-84016172 GTTCTCTGAGCTCTAAAATGGGG - Intergenic
1074816022 10:117140990-117141012 GTTCTCTGTGGCAGTGAATGCGG - Intergenic
1078614392 11:12851845-12851867 GTTCTCTGTGACCCCAGATCTGG - Intronic
1081560177 11:44206793-44206815 ATTCTCTCTGGCCCAAAATCCGG + Exonic
1082212504 11:49522258-49522280 GTTCTTTCTGGCTCTAAATGTGG - Intergenic
1086637089 11:89102239-89102261 GTTCTTTCTGGCTCTAAATGTGG + Intergenic
1087602727 11:100337424-100337446 CCTCCCTGTGGCCCAAAATCAGG + Intronic
1090317682 11:125808914-125808936 TTTCTTTATGTCCCAAAATGTGG + Intergenic
1091182109 11:133614845-133614867 TTTTTCTGTGGCACTAAATGTGG + Intergenic
1092287513 12:7137352-7137374 CTTCTCTGTGTCCCACCATGTGG + Intronic
1102784781 12:115595644-115595666 GTTCTATTTGAGCCAAAATGAGG - Intergenic
1105031320 12:132886276-132886298 TTGCTCTGTGGCCCAGACTGGGG - Intronic
1105999740 13:25710610-25710632 GTTCACTGTGACCCAACTTGAGG + Intronic
1106816245 13:33410499-33410521 CTTCTTTGTTACCCAAAATGAGG - Intergenic
1106855051 13:33842254-33842276 TTGCTCTGTGGCCCAAGCTGGGG - Intronic
1107203235 13:37748226-37748248 GTTTTCTGTGGCAGACAATGAGG + Intronic
1108401592 13:50050673-50050695 GTACTCTGTTGCCCAGGATGGGG + Intergenic
1108907181 13:55491295-55491317 GCTATATGGGGCCCAAAATGGGG + Intergenic
1110861363 13:80347902-80347924 GGTCTCTGTGGTGTAAAATGAGG - Intergenic
1121323767 14:93007893-93007915 GTTGTCTGTGGCTCAACTTGGGG + Intronic
1121415698 14:93777920-93777942 GTGCCGTGGGGCCCAAAATGTGG + Intronic
1122089308 14:99327720-99327742 CTTCCCTGTGGCCCAAAGCGGGG - Intergenic
1123165753 14:106323769-106323791 GTTAACTGTGGCCATAAATGTGG - Intergenic
1123193338 14:106592392-106592414 GTTCTCACTCGCACAAAATGTGG - Intergenic
1123584088 15:21741840-21741862 GTTAACTGTGGCCATAAATGTGG - Intergenic
1123620738 15:22184443-22184465 GTTAACTGTGGCCATAAATGTGG - Intergenic
1124860246 15:33432539-33432561 GGTCTCTGTGGTCAAAAATTCGG - Intronic
1125859991 15:42989768-42989790 GTTCTCTGTGGCCCTACAAGAGG - Intronic
1126696926 15:51334208-51334230 TTCCTCAGTGGCCCAAGATGGGG + Intronic
1127471457 15:59294315-59294337 ATTCTCTGAGGTCCAAAATCAGG + Intronic
1128502560 15:68237454-68237476 GGTCTCTGTTGCCCAAGCTGGGG - Intronic
1131075783 15:89494106-89494128 GTTCTGTGTGGCCCAAGAGTAGG - Intronic
1131560591 15:93436289-93436311 GTTCTCTGTGGCCATACAAGAGG + Intergenic
1136395277 16:29988979-29989001 CTCCTCTGCGGCCCAAAATGGGG + Intronic
1139901731 16:70333455-70333477 GATTGCTGTGGCCCAAGATGGGG + Intronic
1140015035 16:71174571-71174593 GTTCTCTGTGGGCCTAAATGGGG - Intronic
1141061461 16:80876150-80876172 GTTCTCATTGGCACAAGATGCGG - Intergenic
1142110872 16:88330547-88330569 GTTCTCACTGGCCCAGACTGTGG + Intergenic
1142277439 16:89128777-89128799 GTGTTTTGTGGCCCAGAATGTGG + Intronic
1143705503 17:8695196-8695218 CTTCTGGGTGGCCCACAATGGGG + Intergenic
1144481241 17:15630786-15630808 GGTCTCTGTTGCCCAGACTGGGG - Intronic
1144734974 17:17550220-17550242 GTTCTCTGTCACCCAAAGGGAGG + Intronic
1144917073 17:18732945-18732967 GGTCTCTGTTGCCCAGACTGGGG + Intronic
1148706936 17:49642736-49642758 TTTCTCTGTAGCATAAAATGTGG + Intronic
1151382913 17:73737820-73737842 GTCCTCTGGCTCCCAAAATGAGG - Intergenic
1152389228 17:79992864-79992886 GTTCACTGGTTCCCAAAATGAGG - Intronic
1152637051 17:81434541-81434563 GAGCTCTGTGGCCCCAAGTGGGG + Intronic
1153597310 18:6740912-6740934 GTTCACTCAGGCCCACAATGTGG + Intronic
1155638053 18:27978680-27978702 GGTCTCTGTGGCCCAGACTCTGG + Intronic
1155803430 18:30137329-30137351 GTTCTCTTTGGTCCATGATGTGG + Intergenic
1158632575 18:59128918-59128940 GTTATGTGTGGGCCAAAATATGG - Intergenic
1159093443 18:63874726-63874748 GTTCCCAGTGGCCAAAATTGAGG - Intronic
1159101052 18:63959539-63959561 GTGCTTTGTGGCCCAGAATGTGG + Intronic
1160207666 18:76848695-76848717 TTGCTCTGTGGCCCAGACTGGGG + Intronic
1162373855 19:10293906-10293928 GGGCTCTGCGGCCAAAAATGTGG + Exonic
1163645410 19:18486367-18486389 GTACTCTGTGACCCAGAGTGGGG + Intronic
1164714351 19:30380487-30380509 GTTATCAGTGGCCAAAAAAGAGG + Intronic
1167884752 19:52491681-52491703 TTTCTCTGTGGCCCATGCTGGGG - Intronic
1167890295 19:52534855-52534877 TTTCTCTGTGGCCCATGCTGGGG - Intronic
926647046 2:15301455-15301477 GATGTCTGTGACCAAAAATGGGG + Intronic
927249673 2:20986475-20986497 GGTCTCTTTTGCCCAAAGTGAGG - Intergenic
928100641 2:28435593-28435615 CTTCTCTGTGGGCCCACATGTGG + Intergenic
928213070 2:29338127-29338149 GTTCTCTCTGTCCCAAGATCTGG - Intronic
928903225 2:36344002-36344024 TTTCTCTGTGCCCCAAATTCTGG - Intergenic
930860530 2:56067574-56067596 TTTCTCTGTGGCCTATTATGTGG + Intergenic
933077745 2:77950942-77950964 GTTCTCTTTAACCCATAATGTGG + Intergenic
933280887 2:80331542-80331564 GTTCTCTGTGGTGGGAAATGGGG + Intronic
933364710 2:81336448-81336470 GTGTTCTATGGCCCAGAATGTGG - Intergenic
936276630 2:111103351-111103373 CTTCTCTGTGTCTTAAAATGCGG - Intronic
937746269 2:125419345-125419367 GTGTTTTGTAGCCCAAAATGTGG - Intergenic
938236576 2:129710823-129710845 GTTCCCTGCAGCCCAGAATGGGG - Intergenic
942069037 2:172298742-172298764 GCGCTCTGTGGCCCAATATTAGG + Intergenic
942573267 2:177335406-177335428 ATTTTCTGTGGTCCAAAAGGGGG + Intronic
942587152 2:177493618-177493640 GTTCTATGTGGCTCAAATAGAGG + Intronic
944126878 2:196304167-196304189 GTTTTCTGTGGCACATAATATGG - Intronic
944892401 2:204131021-204131043 GTCTTCTGTGTCACAAAATGTGG - Intergenic
946326454 2:218986914-218986936 GTTCCCTGTGGACCAAACTCAGG + Intergenic
947207651 2:227676586-227676608 CTTCTCTGTGGCTCTACATGTGG - Intergenic
947210793 2:227706737-227706759 GTTCTCTGTTGCCCAGGTTGGGG - Intronic
1168853570 20:993221-993243 TTGCTCTGTGGCCCATAGTGGGG - Intronic
1169290489 20:4346447-4346469 GTGTTTTGTGGCCCAGAATGTGG + Intergenic
1171943771 20:31356717-31356739 TTTCTTTGTGGTCTAAAATGTGG - Intergenic
1172948288 20:38705204-38705226 GTTCTCTGTGGCCCAAGACAGGG + Intergenic
1175124806 20:56743219-56743241 TTGCTCTGTTGCCCAGAATGGGG + Intergenic
1178133695 21:29602111-29602133 TTTCTCTGTGGCCTAAAAAAGGG - Intronic
1179559615 21:42206444-42206466 TTGCTCTGTGGCCCAGAATATGG + Intronic
1181456353 22:23062213-23062235 GTTCTCCGTGGCCCCAAAATGGG + Intronic
1181529843 22:23511203-23511225 TTGCTCTGTGGCCCAGGATGGGG - Intergenic
1181963037 22:26636844-26636866 GGACTCTGAGGCCCAGAATGAGG + Intergenic
1182313431 22:29425859-29425881 TTGCTCTGTGGCCCAGGATGGGG - Intergenic
1183727020 22:39595735-39595757 GTCCACTGTGGCCCAAAATTAGG - Intronic
1184210713 22:43034043-43034065 GTTCTCAGTGGCCCAGTAGGGGG - Intergenic
1185159529 22:49214847-49214869 GTTCTCAGAAGCCCAAAGTGCGG - Intergenic
949840228 3:8312205-8312227 GTTTTCTCTGGTCAAAAATGGGG + Intergenic
950874726 3:16261416-16261438 CTACTCTGTTGCCCAATATGTGG + Intronic
952967951 3:38632627-38632649 ATGCTCTGTGGCCCAAACTCAGG + Intronic
953913345 3:46903810-46903832 GCTTCCTGTGGCCCAAACTGGGG + Intergenic
954708134 3:52491954-52491976 GTTCACTGTGGCCCAAAAGATGG + Exonic
956751957 3:72350735-72350757 ATGCACTGTGGCCCAAAATAGGG - Intergenic
957015077 3:75053752-75053774 GTTCATTGTGGGTCAAAATGGGG - Intergenic
957497798 3:81012407-81012429 GTGCTTTATGGCCCAGAATGTGG + Intergenic
959080928 3:101800433-101800455 GTATTTTATGGCCCAAAATGTGG + Intronic
960223157 3:115140636-115140658 GTAATCTGTGCTCCAAAATGAGG + Intronic
961596261 3:128020161-128020183 GTTCTCTTTAGCCCATGATGTGG - Intergenic
961718334 3:128874443-128874465 GTTGTCTATGGCTCAGAATGTGG - Intergenic
965200597 3:165653191-165653213 ATTCTCTGTGGCCTTAAATTAGG - Intergenic
965882358 3:173401039-173401061 TGTCTTTGGGGCCCAAAATGGGG + Intronic
966739163 3:183216078-183216100 GTTCTCTTTGGCCCATCCTGTGG + Exonic
967310116 3:188097954-188097976 ATACACTGTGGCCCAGAATGGGG + Intergenic
967430549 3:189380019-189380041 GTATTTGGTGGCCCAAAATGTGG + Intergenic
967819313 3:193826359-193826381 GTTCTCTGGGGCCCCAGAGGGGG - Intergenic
970544930 4:17118197-17118219 GTGTTTTGTGGCCCAGAATGTGG - Intergenic
971445985 4:26749476-26749498 TTACTCTGTGGCCCAACCTGGGG + Intronic
971710832 4:30109822-30109844 GTTCTTTATGGCCTAGAATGCGG + Intergenic
974229665 4:59093213-59093235 GTTCACTGTGGCCTGACATGGGG + Intergenic
974614172 4:64260616-64260638 TTTCTCTGTTGCCCAGGATGGGG + Intergenic
974632100 4:64506382-64506404 CTGCTTTATGGCCCAAAATGTGG - Intergenic
976919218 4:90416555-90416577 ATTCTCAGTTGCCCAAAATAGGG + Intronic
977663200 4:99615046-99615068 GTCCTCTGTGTCCTAAAACGTGG - Intronic
978048593 4:104166646-104166668 GTTCTCTGTGTAGAAAAATGGGG + Intergenic
979631884 4:122911920-122911942 GTTCAGTGTGGCCCAGAATATGG - Intronic
979952844 4:126916173-126916195 CTACTCTGTTGCACAAAATGAGG + Intergenic
980097646 4:128509526-128509548 GTGTTTTGTGGCCTAAAATGTGG + Intergenic
980290118 4:130837887-130837909 TTACTCTGTGGCCCAACACGTGG - Intergenic
981801526 4:148663174-148663196 GTGCTTTATGGCCCAGAATGTGG + Intergenic
983798187 4:171892848-171892870 GTTCTCTGTGGCTGAGCATGGGG - Intronic
988835402 5:35027701-35027723 ATTCTTTGAGGCCCAGAATGAGG + Intronic
989490278 5:42043626-42043648 GTGCTTTATGGCCCATAATGTGG - Intergenic
989598929 5:43183773-43183795 GTTCTCTCTAGACCATAATGCGG + Intronic
990058818 5:51620942-51620964 GTTCTGTGTGTCACAAAAGGAGG - Intergenic
990876738 5:60494602-60494624 CTTCTTTGTGGCCCACAAAGGGG + Intronic
991527840 5:67582014-67582036 GTGTTTTGTGACCCAAAATGTGG - Intergenic
991769455 5:70026884-70026906 GCTTTCTGTTCCCCAAAATGAGG - Intronic
991848750 5:70902302-70902324 GCTTTCTGTTCCCCAAAATGAGG - Intronic
992717671 5:79526998-79527020 TTGCTCTGTTGCCCAAGATGGGG - Intergenic
992718581 5:79535964-79535986 CTTCTCTCTGACCCAAAATGGGG - Intergenic
992855658 5:80858610-80858632 GTGTTTTATGGCCCAAAATGTGG + Intronic
995691436 5:114830151-114830173 CTTCTCTGTGCCCCACAAGGAGG - Intergenic
995886097 5:116895611-116895633 GTTTTCTGGAGCCCAACATGGGG - Intergenic
996623485 5:125539656-125539678 CTTATCTGTGGCCCAGAATATGG + Intergenic
998243801 5:140477469-140477491 CTTCTCTGTGGCCTAAAACATGG - Intronic
1000073266 5:157761129-157761151 TTGCTCTGTGGCCCAACCTGGGG - Intergenic
1001453350 5:171842862-171842884 ATTCTCTGTGGCCCCAGGTGAGG - Intergenic
1002059122 5:176616010-176616032 GTTTCCTGAGCCCCAAAATGAGG - Intergenic
1003325765 6:5088947-5088969 TTTCTCTGTGCTTCAAAATGTGG + Exonic
1004759410 6:18649558-18649580 GTGCTCTGTCGCCCAGGATGGGG + Intergenic
1005268799 6:24141128-24141150 CTTCTGTGTGGCCCTAAACGAGG + Intronic
1005917944 6:30370578-30370600 GGTCTCTCTGGCCTAAAATAAGG + Intergenic
1006841435 6:37030392-37030414 CTTCACTGTGGAGCAAAATGAGG + Intergenic
1007114471 6:39333870-39333892 GTTCACTCTAGGCCAAAATGTGG - Exonic
1008267458 6:49446724-49446746 TCTCTCTGTTGCCCAAAATAAGG + Intronic
1011023892 6:82845143-82845165 CTTTTCTGTGGCCTAAAATATGG - Intergenic
1013952487 6:115800904-115800926 GTGTTCTGTGGCCCAGAATCTGG - Intergenic
1013981087 6:116130377-116130399 GCTCTCACTGGCCAAAAATGGGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018043011 6:159941533-159941555 GTTCTCTGTGGGCTAAGAGGAGG + Intergenic
1018882859 6:167902855-167902877 CTTCCCAGTGGCCCCAAATGTGG + Intronic
1019264325 7:104206-104228 TTTCTCTGTGGCCCAACATGTGG - Intergenic
1019453476 7:1112207-1112229 GTTTTCTTTGGCCCAGAATGAGG + Intronic
1020395189 7:7707660-7707682 GTTTTCTGTGATCCAAAATCTGG + Intronic
1026313675 7:69209881-69209903 GTACTCTGTTGCCCAGGATGGGG - Intergenic
1026631312 7:72040451-72040473 TTTCTCTGTTGCCCATACTGGGG - Intronic
1026640196 7:72117585-72117607 GGTCCCTTTGGCCCAAACTGGGG + Intronic
1026943839 7:74303936-74303958 TTGCTCTGTGGCCCAGGATGGGG + Intronic
1028035133 7:85972473-85972495 GGAGTCTGTGGCCCAGAATGAGG - Intergenic
1028942332 7:96536318-96536340 GTTCTCTGTGGCCCAAAATGTGG + Intronic
1029351180 7:100014156-100014178 TTGCTCTGTGGCCCAGACTGGGG + Intergenic
1030126009 7:106153211-106153233 GTTCTCTGTGCCTGAAAATAAGG + Intergenic
1030651062 7:112116501-112116523 GTTCTTTGTGGCGGAAAATGGGG - Intronic
1031602723 7:123731544-123731566 GTGTTTTATGGCCCAAAATGTGG - Intronic
1031744025 7:125470709-125470731 GATCTCTGTGGCCCAGGATGAGG + Intergenic
1033277046 7:139979694-139979716 TTGCTCTGTTGCCCAGAATGGGG - Intronic
1033777966 7:144634136-144634158 GCTCTCTTTGGCCCAAATTGTGG - Intronic
1034249654 7:149677905-149677927 GTTCCCTGTGGACCAAATTGTGG + Intergenic
1035332836 7:158107522-158107544 TTTCCCTGTGGCTCACAATGGGG - Intronic
1036482356 8:9150559-9150581 CTTCTCCGCGGCCCAAAAGGTGG - Exonic
1036781593 8:11651573-11651595 GTCATCTGAGGACCAAAATGAGG + Intergenic
1039226046 8:35389429-35389451 GTTCTCTGTTACTCAAAGTGTGG - Intronic
1042601664 8:70504822-70504844 TTTCTATTTGGCCTAAAATGTGG + Intergenic
1042714560 8:71758547-71758569 CTTATCTGAGGTCCAAAATGGGG + Intergenic
1042716324 8:71777011-71777033 CTTCTCTGTGTTCCAAAATTAGG - Intergenic
1045766370 8:105675552-105675574 GTTCTTTGTGGGCCAGAACGTGG + Intronic
1046096574 8:109569739-109569761 TTTCTCTGTTGCCCTAAATAAGG - Intergenic
1047720703 8:127636412-127636434 GTTAGTTGTGGCCAAAAATGGGG - Intergenic
1049027056 8:139999655-139999677 TTTTTCTGTGGCCTAGAATGTGG - Intronic
1049249831 8:141582374-141582396 GTGCTCTGGGCCCCAAGATGGGG + Intergenic
1049837488 8:144747354-144747376 GTGTTTTGTGGCCCAGAATGTGG + Intronic
1049849908 8:144825488-144825510 GTTCTATCTGGCCAAATATGAGG + Intergenic
1049969285 9:807486-807508 CTGCTCTGTGTCCCAAAATCTGG + Intergenic
1050464115 9:5903226-5903248 GTGTTTTGTGGCCCAGAATGTGG + Intronic
1051072411 9:13187614-13187636 ATTCTCTGTGGACTAAAAAGTGG + Intronic
1051426899 9:16941317-16941339 GTTCCCTGAGCCCCAGAATGTGG + Intergenic
1051731067 9:20143293-20143315 TTTCTCTATGGCCCAAGATTGGG - Intergenic
1053554904 9:39126090-39126112 GTGTTCTGTGGCCTAGAATGTGG - Intronic
1053819021 9:41946346-41946368 GTGTTCTGTGGCCTAGAATGTGG - Intronic
1054109287 9:61089998-61090020 GTGTTCTGTGGCCTAGAATGTGG - Intergenic
1054611570 9:67241127-67241149 GTGTTCTGTGGCCTAGAATGTGG + Intergenic
1054847834 9:69815652-69815674 GTTCTCTGTGGCCTTTAATCTGG - Intergenic
1056572341 9:87826551-87826573 TTTCTCTGTAGACCAAGATGTGG + Intergenic
1057132629 9:92664670-92664692 GTTCCCTGTGGCCCTCACTGTGG - Intronic
1058871673 9:109207236-109207258 GAGTTGTGTGGCCCAAAATGTGG + Intronic
1059394983 9:114028603-114028625 GTTCTCTGTGGCACAAGAAGAGG + Intronic
1060934458 9:127507198-127507220 GGTCTCTGTGGTCCAGGATGAGG - Exonic
1061202647 9:129146542-129146564 GTTTTCTGTGGCCAAAGGTGTGG + Intronic
1061329680 9:129884818-129884840 GCTCTCTGGGGCTCAAAATTAGG - Intergenic
1061388845 9:130306111-130306133 GGCCTCTGTGACCCAAAAAGTGG - Intronic
1186180351 X:6967583-6967605 GTTTTCTGAGCCCCAACATGGGG - Intergenic
1186485947 X:9934404-9934426 TTTCTCTGTGGGCCAAAACTGGG + Intronic
1188714654 X:33447065-33447087 GTTCACTGTGACACAAAATAAGG - Intergenic
1189726783 X:43975412-43975434 GTTCTCTGGAGCCCAATGTGGGG - Intergenic
1191645486 X:63476297-63476319 GTGCTCTGTGGCCAAGCATGTGG - Intergenic
1192250738 X:69411441-69411463 GTTCTCTGTGGGACAAAATTTGG - Intergenic
1192684526 X:73289383-73289405 CTTCTCTGTGCCCCACAAGGAGG - Intergenic
1192936658 X:75866926-75866948 TTTGTTTGTGGCCCAAGATGTGG + Intergenic
1194056471 X:89140247-89140269 ATTCTCTAAGGCCCAAAGTGTGG + Intergenic
1195031028 X:100928031-100928053 GATCTCTGTGGACAAAAATGAGG + Exonic
1195751732 X:108166115-108166137 ATTCTCTTTGGCCAAAAAGGGGG - Intronic
1196414876 X:115460244-115460266 GTTCTGTGTAACCCTAAATGTGG - Intergenic
1197831103 X:130643925-130643947 GTGCTTTATGGCCCATAATGTGG - Intronic
1198880182 X:141272623-141272645 GCTCTGTGTGGCCCCAGATGGGG - Intergenic
1199547343 X:149019842-149019864 GTTCTCTGAGGCCCTAGTTGTGG + Intergenic
1199810013 X:151339842-151339864 CTGCTCAGTGGGCCAAAATGTGG + Intergenic
1200175406 X:154111900-154111922 GTGCTTTATGGCCCAGAATGTGG + Intergenic
1201538146 Y:15074510-15074532 TTCCTCTGTGGACCAAGATGTGG + Intergenic