ID: 1028944972

View in Genome Browser
Species Human (GRCh38)
Location 7:96569154-96569176
Sequence TAATATCATCACATCCTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028944972_1028944976 -8 Left 1028944972 7:96569154-96569176 CCAATAAGGATGTGATGATATTA 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1028944976 7:96569169-96569191 TGATATTAAGGTGGTGGTAGTGG 0: 1
1: 1
2: 2
3: 26
4: 275
1028944972_1028944977 -7 Left 1028944972 7:96569154-96569176 CCAATAAGGATGTGATGATATTA 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1028944977 7:96569170-96569192 GATATTAAGGTGGTGGTAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 233
1028944972_1028944978 15 Left 1028944972 7:96569154-96569176 CCAATAAGGATGTGATGATATTA 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1028944978 7:96569192-96569214 GAAGTCAGTCTTGATTCCTTTGG 0: 1
1: 0
2: 0
3: 6
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028944972 Original CRISPR TAATATCATCACATCCTTAT TGG (reversed) Intronic
903726053 1:25445716-25445738 TAATTTGATCACATCAGTATTGG + Intronic
905118904 1:35666603-35666625 TAATCTCATTTCATCCTCATTGG - Intergenic
907763937 1:57389573-57389595 TATTATCCTAACATCCTTCTGGG + Intronic
909112957 1:71503257-71503279 TAATAAAATCCCATCCTCATAGG + Intronic
909417189 1:75419727-75419749 TAATCTCTTCAAATCCTAATAGG + Intronic
909967103 1:81927631-81927653 TAATATCCTAACATACCTATAGG + Intronic
910486027 1:87714964-87714986 TTATATCATATCATTCTTATAGG + Intergenic
912788444 1:112627029-112627051 TTATCTCACAACATCCTTATAGG + Intronic
915090894 1:153425022-153425044 TAATATTGTTACATACTTATGGG - Intergenic
917497821 1:175557325-175557347 TAATATTATCACAAACTTAGTGG - Intronic
917872876 1:179257444-179257466 TAAGAGCATCACAGTCTTATAGG + Intergenic
918353919 1:183687077-183687099 TAACATAATCACATCCCAATTGG + Intronic
922366969 1:224874987-224875009 TAATATTAACACAGCCTTCTCGG - Intergenic
1063009156 10:2005684-2005706 TAATACCATGACTTTCTTATAGG + Intergenic
1063237537 10:4133896-4133918 TAATATAATAAAATACTTATTGG + Intergenic
1065939870 10:30554701-30554723 TAATTTCCTCACATCTTTTTTGG - Intergenic
1068743732 10:60504432-60504454 TATTATAATCAAATCCTTATGGG - Intronic
1069815230 10:71189618-71189640 TAATCTCATCACCTCCTTTTGGG - Intergenic
1069825937 10:71255025-71255047 TGATGTCATCACATACTTACAGG + Intronic
1072616867 10:97056045-97056067 TAATCTCATAACAACCCTATGGG + Intronic
1074659997 10:115643671-115643693 GAGTATCATCATATTCTTATTGG - Intronic
1074809795 10:117092240-117092262 TATTATGTTCACATCCTTACTGG - Intronic
1076077951 10:127552012-127552034 AAGTATCAAGACATCCTTATGGG + Intronic
1079028750 11:16969393-16969415 TAATATGATTACATCTTAATAGG + Intronic
1079540028 11:21562034-21562056 ACATATCCTCACATCCTTTTTGG + Intronic
1079699730 11:23529774-23529796 TAACATCATTACTTCTTTATAGG + Intergenic
1080112314 11:28581948-28581970 TAATCTAATCACATCCTAAGAGG - Intergenic
1080593832 11:33749751-33749773 AAATACCAACACATACTTATAGG - Intronic
1080702396 11:34655038-34655060 CAATATTGTCACATCCTGATGGG + Intronic
1081242248 11:40721310-40721332 TGTTATCCTCATATCCTTATAGG - Intronic
1085132516 11:74053544-74053566 TAATATCAGCACATCCCTCTTGG + Intronic
1090458210 11:126867633-126867655 TATTACCAGCACATCCTGATGGG - Intronic
1095112617 12:38314965-38314987 AAATAACTTCACAGCCTTATAGG - Intergenic
1097419742 12:59360516-59360538 TAATATCTTGACATTTTTATGGG - Intergenic
1097569221 12:61310927-61310949 TACTATCATCACACCCTCACTGG + Intergenic
1098718155 12:73859319-73859341 TACTATGATCTCATCCTTGTAGG - Intergenic
1106294328 13:28396587-28396609 TAATATGATGACATCGTTTTTGG - Intronic
1109825942 13:67722542-67722564 TAACATAATCACATCTTTAAAGG - Intergenic
1114162521 14:20184634-20184656 TACTTTCATCACTCCCTTATAGG + Intergenic
1114827101 14:26094324-26094346 TTCTATCATCAAATCCTTTTAGG + Intergenic
1115100526 14:29692772-29692794 AAATGTCATCATGTCCTTATAGG + Intronic
1116701527 14:48250252-48250274 TAATGTAATAATATCCTTATAGG - Intergenic
1118498168 14:66329479-66329501 TAATATAATCACCTCATTTTTGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125317246 15:38443993-38444015 AAATATCACCATATACTTATAGG - Intergenic
1125698935 15:41662482-41662504 TTTTATCGTCACAACCTTATAGG - Intronic
1126580002 15:50234141-50234163 TGATATTACCACTTCCTTATTGG - Intronic
1126591872 15:50348182-50348204 TAATATAATCACAGCATTAGTGG + Intronic
1126659025 15:51013144-51013166 TAATTTTATCACATACATATGGG + Intergenic
1129671381 15:77609711-77609733 TACTAGCATGACATCTTTATGGG - Intergenic
1130782206 15:87052879-87052901 TATTATCATCACATCTTTGCAGG - Intergenic
1131047896 15:89327560-89327582 CAATATCATCCCATCCTCAGGGG + Intronic
1132405245 15:101537996-101538018 AAATATGATGACACCCTTATAGG + Intergenic
1137663478 16:50231538-50231560 TAATATAATCACATGCTTATTGG - Exonic
1140679378 16:77369148-77369170 TGATATCCTCACATGTTTATGGG + Intronic
1141358774 16:83374991-83375013 TTATATCATTACATCATTTTCGG - Intronic
1141624950 16:85256246-85256268 TATTATCATCACATGTTTGTTGG - Intergenic
1143624991 17:8104524-8104546 TTAAATCATTACATCCTAATAGG - Intronic
1146381118 17:32328366-32328388 TAATTTCCTCACAACCTTGTTGG + Intronic
1149630497 17:58118036-58118058 TACTATCATGACAGCCTTTTGGG - Intergenic
1149798716 17:59546140-59546162 TGACATCATCATTTCCTTATGGG - Intergenic
1155702142 18:28759763-28759785 TAATATTATTACATCCTTCTAGG + Intergenic
1158721040 18:59924968-59924990 TAATTTAATCACATCTTTAAAGG - Intergenic
1168268258 19:55235242-55235264 AAATGTCATCACAGCCTGATTGG + Intronic
925738970 2:6988568-6988590 TATTCTCATCACATCCTGGTGGG + Intronic
926947794 2:18206890-18206912 AGATACCATCACATCCCTATTGG - Intronic
927341640 2:21990207-21990229 TAATATCATAACAAGCATATGGG + Intergenic
938034292 2:128023452-128023474 GAAGATCATAACATCATTATGGG - Intronic
939729872 2:145769886-145769908 TAATATAATCACACACTTCTAGG - Intergenic
941495661 2:166199391-166199413 TTATATCATCATATCCTTCCTGG - Exonic
942317724 2:174710350-174710372 TAATATCATCCCATCATTCCTGG + Intergenic
942468288 2:176231899-176231921 TAATGTCATCTCATCCATCTAGG + Intergenic
944248287 2:197555634-197555656 TAATATCAGCAAATACTTGTAGG - Intergenic
945957844 2:216102857-216102879 TAAAATCATTACATACATATAGG - Intergenic
946123306 2:217536120-217536142 TTATTTCCTCACATCATTATGGG - Intronic
1168736155 20:138645-138667 TATTATAATCACATCCTCAAGGG + Intergenic
1169084338 20:2817303-2817325 GGGTATCATCACATCCATATGGG - Intronic
1170178027 20:13494692-13494714 TAATATCATCACATGAATAAAGG + Intronic
1172425859 20:34855615-34855637 TCATCTCATCAAATCCTTATGGG + Intronic
1173705406 20:45106786-45106808 TGAAATCCTCATATCCTTATCGG - Intergenic
1177847463 21:26307014-26307036 TAACATAATCACAGGCTTATTGG - Intergenic
1179026401 21:37682632-37682654 TAACCTAATTACATCCTTATAGG + Intronic
1182841168 22:33391153-33391175 CAATATCCTCACATCCTCATAGG + Intronic
1184957554 22:47901747-47901769 TCAGATCATCACATTCTTATTGG - Intergenic
950895303 3:16444387-16444409 TAATTTCTTCATATCCCTATGGG + Intronic
951054021 3:18126618-18126640 TAAAATCATCACACCATAATGGG + Intronic
955884408 3:63582710-63582732 TAATCTCAGCAAATCCTTAATGG + Intronic
955998212 3:64700150-64700172 TAATCTCATTACCTCCTTAAAGG + Intergenic
956257840 3:67303617-67303639 TAATATTATCACAACATTAAGGG + Intergenic
957254895 3:77824500-77824522 TAATATAATCCCATATTTATTGG + Intergenic
957619889 3:82582270-82582292 AAATATTATAATATCCTTATAGG - Intergenic
957880799 3:86210360-86210382 TAACATCATCACAACCACATTGG - Intergenic
958779496 3:98523461-98523483 TAATATCATTACATTCTTGATGG - Intronic
961902666 3:130228291-130228313 TAATATCTGCACATATTTATGGG + Intergenic
963197421 3:142548182-142548204 TAATATCATCAACTCATTATTGG + Intronic
964430236 3:156598094-156598116 TGTTATCATCCCATTCTTATAGG + Intergenic
965797676 3:172458169-172458191 TAATATCCCCACATCCTTCAAGG - Intergenic
970131680 4:12878193-12878215 TAATAACATGACATTTTTATGGG - Intergenic
970587033 4:17523991-17524013 AAATCTCACCACATCCCTATGGG + Intronic
970954580 4:21795113-21795135 TAACTTCATCACCTCCTTAAAGG - Intronic
971061862 4:22980095-22980117 TAATAAAGTCACATCCTTAAAGG + Intergenic
977110604 4:92949054-92949076 TTGTATCATTACATGCTTATAGG - Intronic
977501722 4:97848497-97848519 TAATATCATCAAGTATTTATAGG + Intronic
977916405 4:102599110-102599132 TCAAATCCTCACACCCTTATGGG - Intronic
978131131 4:105199213-105199235 AAACATGATTACATCCTTATAGG + Intronic
978842467 4:113230801-113230823 TAATATTATAACATTATTATAGG - Intronic
979151411 4:117320858-117320880 TAATATCATCATCACCTTAGAGG - Intergenic
979428046 4:120592359-120592381 TTATATTGTAACATCCTTATTGG + Intergenic
979618737 4:122774453-122774475 TAATACCATGACATTTTTATGGG + Intergenic
982662698 4:158225765-158225787 TAAACTCATCACATCCTTTCAGG + Intronic
982869463 4:160559464-160559486 TATTATCATCACCTCCTTGCAGG + Intergenic
982988218 4:162237163-162237185 TAGAATAATCACATCCTGATGGG + Intergenic
983275624 4:165613742-165613764 TGTTAGCATCACATTCTTATGGG - Intergenic
983864708 4:172751394-172751416 AAATATCAGCACATCTTAATAGG + Intronic
986641853 5:9879696-9879718 TATAATCATCACATCTCTATGGG - Intergenic
988714904 5:33815817-33815839 TAATATCATCAGAACTTTAGAGG - Intronic
988938190 5:36112270-36112292 TACCATCTTCATATCCTTATGGG + Intronic
989261161 5:39421699-39421721 TAATATCAGCATATCCTGACTGG - Intronic
990352912 5:54936876-54936898 TAATGTCATCACCTCTTTAAAGG + Intergenic
990676131 5:58187543-58187565 TTATAACATCACATCTTTAGTGG + Intergenic
991156724 5:63445151-63445173 TAATTTCCCCACCTCCTTATGGG - Intergenic
992153507 5:73930351-73930373 TAATATCATTTCATTTTTATTGG + Intronic
992416528 5:76557338-76557360 TGATAGCATCTCTTCCTTATGGG + Intronic
992585228 5:78231743-78231765 TAATAATAGCAAATCCTTATAGG + Intronic
993708808 5:91201633-91201655 GAAAAATATCACATCCTTATTGG - Intergenic
995194458 5:109348040-109348062 TAATAGCATCCCATTCTCATTGG - Intronic
996314126 5:122142135-122142157 TAATGGCATCTTATCCTTATTGG + Intronic
1000950962 5:167482578-167482600 TTTTATCAACACATCCTTTTGGG + Intronic
1001000631 5:168003402-168003424 TAATTTCATCCCACCCTTTTTGG - Intronic
1001290833 5:170458181-170458203 TAATATAATCCCAGACTTATTGG - Intronic
1001379729 5:171296586-171296608 TAATATTTTTACATCATTATGGG - Intronic
1001548540 5:172585953-172585975 CAATCTCATCACTTCCCTATAGG + Intergenic
1003283505 6:4714031-4714053 TGATATCATCTCATGCTTACGGG + Intronic
1005085950 6:22006813-22006835 TAATGTAATCACCTCTTTATAGG - Intergenic
1005296564 6:24433026-24433048 TAATCTCATCACTTCCTTGGTGG - Intronic
1005709845 6:28492496-28492518 TATTATTATCACATCAATATTGG + Intergenic
1009349113 6:62652526-62652548 GAATAACATAACATCCTTCTAGG + Intergenic
1009367319 6:62865557-62865579 TAATATCATCCTTTCCTTTTTGG + Intergenic
1009758237 6:67969008-67969030 TATTTTCATCAAATCCTTATGGG + Intergenic
1010122657 6:72396053-72396075 TAATATTATCACAACCAAATGGG + Intronic
1010882243 6:81192292-81192314 TACTATCATCACAACTTTTTTGG - Intergenic
1011136444 6:84105722-84105744 CAATATCATAACTTCCTTCTTGG + Intergenic
1011800371 6:91006423-91006445 TAATACCATCACATCTATCTTGG + Intergenic
1012457442 6:99423291-99423313 TTATTTTATCATATCCTTATGGG - Intronic
1013335537 6:109155961-109155983 TTATATCTTCAAATCCTTTTTGG - Intronic
1016740332 6:147521080-147521102 TAATTTAAACATATCCTTATTGG + Intronic
1017250690 6:152276773-152276795 TGATACCATCAGATGCTTATAGG + Intronic
1017392509 6:153956813-153956835 TAATTACATCCCATCCATATGGG - Intergenic
1017892549 6:158651282-158651304 TAATATTATTATATCCTTCTAGG - Intronic
1018396848 6:163384580-163384602 TAATAGCAACACATCCTTAAGGG - Intergenic
1021188102 7:17588891-17588913 CAAAATCATCTCTTCCTTATAGG + Intergenic
1021860627 7:24902526-24902548 AATTATCATCACAGCCTCATGGG - Intronic
1024886403 7:54147473-54147495 TAATATAATCACATCTTTGAAGG + Intergenic
1026282559 7:68934583-68934605 ACAAATCATCACAACCTTATAGG - Intergenic
1026377167 7:69763459-69763481 TAATATCTTCTCATTCTTGTAGG + Intronic
1027583827 7:80032289-80032311 TAATATCAGCACAGATTTATAGG + Intergenic
1027652953 7:80893517-80893539 TATTCTCATCATCTCCTTATGGG + Intronic
1028294219 7:89107516-89107538 TAATAACTTCACATCTTTTTAGG + Intronic
1028944972 7:96569154-96569176 TAATATCATCACATCCTTATTGG - Intronic
1028998906 7:97131601-97131623 TAATATAATCACATCTTAAGAGG - Intronic
1030457590 7:109794073-109794095 AAATAATATCACATCCTTAGAGG - Intergenic
1031831671 7:126634730-126634752 TAATATTATCAAATGATTATTGG + Intronic
1033470523 7:141643725-141643747 TAATATTATGTAATCCTTATAGG + Intronic
1033983948 7:147199933-147199955 TAATATAAACACATGCTAATAGG + Intronic
1034385786 7:150740009-150740031 TAATTTCCTGTCATCCTTATGGG - Intronic
1034834239 7:154336982-154337004 TAATATCATCAGATGCTCACTGG - Intronic
1035890512 8:3337772-3337794 TAAAATAATCAGATCCCTATAGG - Intronic
1036003909 8:4639776-4639798 TAATATTATCAAATGCTTGTGGG + Intronic
1039866647 8:41510842-41510864 AAATATTAACACATACTTATGGG - Exonic
1041872748 8:62653410-62653432 AAATATCATCACATTATGATGGG + Intronic
1045619057 8:103953083-103953105 TAACATCATCCCATACTTCTTGG - Intronic
1045723965 8:105149089-105149111 TATTATTATTACATACTTATTGG + Intronic
1045759012 8:105581885-105581907 TGATACCATCACATCGTTGTGGG + Intronic
1045924944 8:107572370-107572392 TAATATCATCGTCTCCTTCTTGG - Intergenic
1045925077 8:107573197-107573219 TAATATCATCATCTCCTTCTTGG - Intergenic
1048864757 8:138751614-138751636 TAATACCATCCCATTCTGATGGG + Intronic
1049913154 9:289804-289826 TAATAACAACATATCCATATTGG - Intronic
1051766738 9:20532973-20532995 TAATATCATCACCACCTTGGTGG + Intronic
1057411727 9:94822228-94822250 CAAGATCAACACATCCTTAAAGG - Intronic
1058114889 9:101073916-101073938 GAATATCATCACATGATAATAGG - Intronic
1186012581 X:5151529-5151551 TAATTTCATCACCTCTTTAAAGG - Intergenic
1187824802 X:23324224-23324246 TATTATCATGACCTCCTAATTGG + Intergenic
1188090478 X:25958479-25958501 TAAAAGCATCACATATTTATTGG + Intergenic
1188120671 X:26303295-26303317 TAAAATCACCACTTCCTTATGGG - Intergenic
1189367949 X:40403560-40403582 TAATTTAATCACATCTTTAAGGG - Intergenic
1189797133 X:44655889-44655911 TACTACCAACACATCCTTGTGGG - Intergenic
1190849969 X:54230466-54230488 TTATATCATCAAATACCTATTGG + Intronic
1193480074 X:82016844-82016866 TAATATCGTCCCACCCTTAGAGG + Intergenic
1193791772 X:85822861-85822883 TAATATAATCCCAGCCTTTTTGG - Intergenic
1194696879 X:97063449-97063471 TTCTACCATCCCATCCTTATTGG - Intronic
1198321623 X:135522894-135522916 AAAAATGATCACATCCTTTTGGG - Intronic
1198616578 X:138464328-138464350 TAATATAATCCCAGACTTATTGG - Intergenic
1200841860 Y:7790247-7790269 TAATTTCTTCATGTCCTTATGGG + Intergenic