ID: 1028946776 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:96589082-96589104 |
Sequence | TGAAGGCTGCACCCAGGTGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1028946770_1028946776 | 2 | Left | 1028946770 | 7:96589057-96589079 | CCTCTGATGATGGCTATTGCCTG | 0: 1 1: 0 2: 0 3: 11 4: 165 |
||
Right | 1028946776 | 7:96589082-96589104 | TGAAGGCTGCACCCAGGTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1028946776 | Original CRISPR | TGAAGGCTGCACCCAGGTGT GGG | Intronic | ||