ID: 1028946776

View in Genome Browser
Species Human (GRCh38)
Location 7:96589082-96589104
Sequence TGAAGGCTGCACCCAGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028946770_1028946776 2 Left 1028946770 7:96589057-96589079 CCTCTGATGATGGCTATTGCCTG 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1028946776 7:96589082-96589104 TGAAGGCTGCACCCAGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028946776 Original CRISPR TGAAGGCTGCACCCAGGTGT GGG Intronic