ID: 1028948471

View in Genome Browser
Species Human (GRCh38)
Location 7:96607620-96607642
Sequence CACAATCAATGTACATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028948471_1028948475 2 Left 1028948471 7:96607620-96607642 CCACCTCATGTACATTGATTGTG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1028948475 7:96607645-96607667 ATCCCCAGCTGCCCACAATTGGG No data
1028948471_1028948483 25 Left 1028948471 7:96607620-96607642 CCACCTCATGTACATTGATTGTG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1028948483 7:96607668-96607690 CCCACTGAACTTCCGGCAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 108
1028948471_1028948474 1 Left 1028948471 7:96607620-96607642 CCACCTCATGTACATTGATTGTG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1028948474 7:96607644-96607666 CATCCCCAGCTGCCCACAATTGG No data
1028948471_1028948481 18 Left 1028948471 7:96607620-96607642 CCACCTCATGTACATTGATTGTG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1028948481 7:96607661-96607683 AATTGGGCCCACTGAACTTCCGG 0: 1
1: 0
2: 1
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028948471 Original CRISPR CACAATCAATGTACATGAGG TGG (reversed) Intronic
908771639 1:67602259-67602281 CAAAATCAATGTACATAAATTGG + Intergenic
910925570 1:92394708-92394730 CACAATCCATGTTCATGAATTGG + Exonic
921530695 1:216278941-216278963 AACAATCAATTTTCATGAGTAGG + Intronic
921886146 1:220308476-220308498 CACAAGCAAAAAACATGAGGGGG - Intergenic
924355322 1:243167882-243167904 CATATTGAATGTATATGAGGAGG - Intronic
924664259 1:246054471-246054493 CACAGTGAATGTCCATCAGGAGG + Intronic
1063259696 10:4372957-4372979 CCCAAGAAATGTACAGGAGGTGG - Intergenic
1070387073 10:75935283-75935305 CACAATCATTGTTCATCCGGGGG - Intronic
1070460015 10:76656398-76656420 CAAAATCAATGTACAAAAAGTGG + Intergenic
1076502883 10:130950882-130950904 CACCATCAGTGTCCATGGGGGGG - Intergenic
1077910864 11:6570478-6570500 CTCAATAAAGGTATATGAGGGGG + Intronic
1080138369 11:28885216-28885238 CACAATAAATATACATGTGCAGG - Intergenic
1090698425 11:129272135-129272157 GACAATAAATGTAAATGAAGGGG + Intronic
1092917107 12:13199068-13199090 CACAAACAATGTAAATGTGGGGG - Intronic
1093228706 12:16516341-16516363 CAAAATCAATGTATTTGAGTTGG - Intronic
1095241777 12:39868629-39868651 CACTACCAAAATACATGAGGGGG + Intronic
1095400965 12:41814315-41814337 CACAATCTATGTCCAAGAAGAGG + Intergenic
1095905646 12:47375022-47375044 CAAAATCAATGTACAAAAGCCGG + Intergenic
1098499966 12:71180328-71180350 CAAAATCAATGTACATAAATAGG + Intronic
1100814237 12:98370437-98370459 CACAATAAGTGTCCATGAAGTGG + Intergenic
1104188844 12:126458481-126458503 CACAATCAAGGAGCATGATGAGG - Intergenic
1106602068 13:31196760-31196782 CACAATCAGTGCACACTAGGGGG - Intergenic
1110483259 13:76007858-76007880 AAAAATCAATGTGCATGAAGTGG - Intergenic
1112035213 13:95491278-95491300 AATAATCAATGTTCCTGAGGAGG - Intronic
1115397034 14:32920002-32920024 AACAATGACTGTACATGATGAGG + Intergenic
1120727740 14:87963913-87963935 ACCAATAAATGTACATGTGGTGG - Intronic
1122005486 14:98700026-98700048 CACAATCAATGCACATTGGGTGG - Intergenic
1129992471 15:79977104-79977126 CACAATGAATATTCATGAGGTGG - Intergenic
1131016077 15:89058715-89058737 GCCAATCATTGGACATGAGGGGG - Intergenic
1138251361 16:55504370-55504392 CACATTCCATGTACCAGAGGTGG - Intronic
1140591259 16:76355448-76355470 CACTATCACTGAACATCAGGAGG - Exonic
1143285682 17:5787443-5787465 CACCTTCCATGTACATGATGCGG - Intronic
1145024863 17:19460718-19460740 CACACTCAATGTGTAAGAGGCGG + Intergenic
1149121460 17:53171434-53171456 CAGAGTCAATGTTCATGAGTTGG - Intergenic
1149670665 17:58406056-58406078 CAGAATCACTGCACATCAGGTGG - Intronic
1149688863 17:58556444-58556466 CACAATCAAAGTACAGGTAGTGG - Intergenic
1153282798 18:3429708-3429730 CACAATCAAAGTACAAGATAGGG + Intronic
1155103208 18:22634544-22634566 CAGTATCAATGTGCATGAGCTGG - Intergenic
1155396907 18:25395879-25395901 AACCCTCAATGTATATGAGGAGG + Intergenic
1158314160 18:56192093-56192115 CACAAGCAATGTGGATGAGCTGG + Intergenic
1165681361 19:37779144-37779166 CGCAATCAACGTACATGAAAAGG + Intronic
1165749505 19:38251532-38251554 CACAATCAGAGAACAGGAGGAGG - Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
929397924 2:41544771-41544793 GAAACTTAATGTACATGAGGCGG - Intergenic
932689404 2:73899682-73899704 CTCAGTCAATGTCAATGAGGAGG - Intronic
933364042 2:81325393-81325415 CACATTCAATAAACATGTGGAGG - Intergenic
933504750 2:83162549-83162571 CACAAGTAAGTTACATGAGGAGG - Intergenic
935461570 2:103342014-103342036 CATAATCAATGTACTTTAGTTGG - Intergenic
936562344 2:113551925-113551947 CTCTATCACAGTACATGAGGTGG + Intergenic
937763077 2:125628652-125628674 TTCAGTCAGTGTACATGAGGAGG + Intergenic
938725635 2:134106538-134106560 CAGAATCACTGAACATGAGTTGG + Intergenic
939666290 2:144956132-144956154 CACAATCAATGTACTTTTGTGGG + Intergenic
944994370 2:205277226-205277248 CACAAACAATGTACAGAATGGGG + Intronic
945175908 2:207043077-207043099 TACAACCAATGTAGATGAAGAGG - Intergenic
945675925 2:212855634-212855656 CAAAATCACTGGACATCAGGAGG - Intergenic
1179203047 21:39244727-39244749 CAAATTCAAGGTACTTGAGGCGG + Intronic
949118724 3:359743-359765 TACAAGCAATGTACATGAAGTGG + Intronic
954145770 3:48633581-48633603 CACAAGCAATGGACCTGCGGAGG - Exonic
961582714 3:127895704-127895726 AACAAGCAATGTTCATGAAGAGG + Intergenic
963132821 3:141874618-141874640 CACACACAATGTAAATGAAGCGG + Intergenic
964856910 3:161156428-161156450 AACAATCAAAATACATGGGGAGG + Intronic
967012882 3:185453073-185453095 CACTATCAATGTGGATAAGGGGG + Intronic
973036155 4:45409978-45410000 AACAATCATTGTCCATGATGAGG + Intergenic
978159845 4:105532818-105532840 CCCAATCAATATACATCATGAGG - Intergenic
979155979 4:117391738-117391760 CAAATCCAATGTACTTGAGGGGG + Intergenic
979246480 4:118511749-118511771 CATATTGAATGTATATGAGGAGG + Intergenic
987142025 5:14956379-14956401 CTCTATCATTGTACATGAAGAGG + Intergenic
988028675 5:25733518-25733540 CAGACACAATGTACATGAGAAGG - Intergenic
989678926 5:44006626-44006648 CACAAGCAAGCTGCATGAGGAGG - Intergenic
991567941 5:68024179-68024201 CAAGAACAAAGTACATGAGGTGG + Intergenic
991670187 5:69039388-69039410 CTCAATCAATATATATTAGGAGG - Intergenic
994291348 5:98031760-98031782 CACAAGTAAATTACATGAGGAGG - Intergenic
996652953 5:125903648-125903670 CACAATCAATTTTCATGATGAGG + Intergenic
1000507769 5:162143075-162143097 CACAATCAACTTTCATGAGCTGG - Intronic
1001545798 5:172569887-172569909 CAGACTCAATGTAAACGAGGTGG - Intergenic
1008788548 6:55199943-55199965 TACATTCATTGTACAAGAGGTGG - Intronic
1010128524 6:72463818-72463840 TACAATCAATGAAAATGAAGAGG + Intergenic
1015616925 6:135087233-135087255 TACATTCAATATACATTAGGAGG + Intronic
1017416397 6:154225655-154225677 CACAATCTAGATAGATGAGGGGG + Intronic
1018439949 6:163802408-163802430 CACAATCAATCAACATGACCTGG + Intergenic
1027745400 7:82067634-82067656 CACAATCAATGTAACTGAAATGG + Intronic
1028948471 7:96607620-96607642 CACAATCAATGTACATGAGGTGG - Intronic
1031221177 7:118967777-118967799 AACAATCAATGAACTTGAGGGGG - Intergenic
1036821492 8:11943212-11943234 CACTGTCAATGGACAAGAGGCGG + Intergenic
1041795795 8:61746608-61746630 TTCAATCATTGTACATGAGGTGG - Intergenic
1044381780 8:91542203-91542225 CTCAAGCAAGGTGCATGAGGTGG + Intergenic
1045221862 8:100207275-100207297 CACAAATAAGTTACATGAGGAGG + Intronic
1046244471 8:111540377-111540399 CACAATCATTGGAGAAGAGGAGG - Intergenic
1048819148 8:138363860-138363882 CATAAACTATGTAAATGAGGTGG + Intronic
1049125833 8:140786958-140786980 AAAAAACAATGTAGATGAGGAGG + Intronic
1049890340 9:63407-63429 CTCTATCACAGTACATGAGGTGG - Intergenic
1050920921 9:11199588-11199610 CCCAATCAATGTAGCTGATGAGG + Intergenic
1053564900 9:39239034-39239056 CACCATCACTGAACATCAGGAGG + Exonic
1053731802 9:41064592-41064614 CTCTATCACAGTACATGAGGTGG - Intergenic
1053830677 9:42076910-42076932 CACCATCACTGAACATCAGGAGG + Exonic
1054132250 9:61380005-61380027 CACCATCACTGAACATCAGGAGG - Intergenic
1054599882 9:67110527-67110549 CACCATCACTGAACATCAGGAGG - Intergenic
1054696654 9:68367128-68367150 CTCTATCACAGTACATGAGGTGG + Intronic
1056850811 9:90082196-90082218 CACAACCAATGTCACTGAGGGGG + Intergenic
1057708505 9:97415580-97415602 CACTAATAATGCACATGAGGTGG - Intronic
1059324063 9:113492811-113492833 CACAATTAATGTCCATAAGCAGG - Intronic
1060082812 9:120667699-120667721 CTCATTCGATGTACATGAAGAGG - Intronic
1186916861 X:14232460-14232482 CACAATAAATGTTCATTAAGTGG - Intergenic
1187804037 X:23098561-23098583 CACATTCCATGTTCATGAGTAGG + Intergenic
1190431613 X:50383182-50383204 CATAATCAGTTTACATGAGCTGG - Intronic
1192502509 X:71663223-71663245 CACAATCATGGTACCTTAGGAGG - Intergenic
1192509712 X:71714599-71714621 CACAATCATGGTACCTTAGGAGG - Intronic
1192516985 X:71766954-71766976 CACAATCATGGTACCTTAGGAGG + Intronic
1193728753 X:85076783-85076805 CTCCATTAATGTACATGAGATGG - Intronic
1194253897 X:91613196-91613218 CACAATCAGGGTACATGTGTTGG + Intergenic
1196590355 X:117480464-117480486 AACAATCAATGTTCTTGAGTAGG - Intergenic
1200572682 Y:4852773-4852795 CACAATCAGGGTACATGTGTTGG + Intergenic