ID: 1028950042

View in Genome Browser
Species Human (GRCh38)
Location 7:96624402-96624424
Sequence GTGTAGTGGGTCAAGTGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028950035_1028950042 18 Left 1028950035 7:96624361-96624383 CCTCATTTTGTCAAGAGAGTCTC 0: 1
1: 0
2: 0
3: 13
4: 186
Right 1028950042 7:96624402-96624424 GTGTAGTGGGTCAAGTGGGTCGG 0: 1
1: 0
2: 1
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028950042 Original CRISPR GTGTAGTGGGTCAAGTGGGT CGG Intronic
900617050 1:3570226-3570248 CTGAAGTGGGTTGAGTGGGTGGG - Intronic
902109022 1:14062355-14062377 GTGTAGTGCCTCAAGTAGGATGG - Intergenic
903500223 1:23796472-23796494 GTGAGGTGGGTGAGGTGGGTGGG + Intronic
903990023 1:27260779-27260801 CTGGAATGGGTGAAGTGGGTGGG - Intronic
905014508 1:34768078-34768100 GTGTGGTGGGTGAGGAGGGTGGG - Intronic
905275738 1:36816868-36816890 GTGATGTGGGCCAACTGGGTTGG - Intronic
907924691 1:58944484-58944506 GTGTACTGGGGCAAGGGGGTTGG - Intergenic
909660483 1:78076433-78076455 ATGTATTGGGACAAGTGGGATGG + Intronic
911711957 1:101083925-101083947 GAGGAGGGGGTTAAGTGGGTTGG + Intergenic
911781840 1:101889501-101889523 GTGGAGTGGGTCAAGGGGGGAGG + Intronic
912758996 1:112349118-112349140 GGGTAGTGGGTCAGGTGCGGTGG - Intergenic
916533661 1:165682339-165682361 GTGTATTGGGAGAAGTGGGGAGG - Intronic
917968586 1:180193677-180193699 GTCCAGAGGGTCCAGTGGGTGGG + Intronic
920685305 1:208104653-208104675 GTGTAGGGTGTACAGTGGGTGGG + Intronic
920930421 1:210382819-210382841 GTGTTGTGGGGCAAAGGGGTGGG + Intronic
923834010 1:237589814-237589836 TTGGAGTGGCTCAAGTGGGTAGG + Exonic
1067358050 10:45549488-45549510 GTGTAGTGGGTGAACTGTCTTGG - Intronic
1069587280 10:69616492-69616514 CTGCAGTGGGACAAGTGTGTGGG + Intergenic
1069940844 10:71954247-71954269 GTGTAGTGGGTGGTGTTGGTGGG + Intergenic
1070151245 10:73806519-73806541 GAGTAGAGGGTAAAGAGGGTGGG + Intronic
1070514674 10:77193626-77193648 ATGGAGTGGTTCATGTGGGTGGG + Intronic
1070565896 10:77603650-77603672 GTGTAATGGGGCAGGTGGTTGGG - Intronic
1071504092 10:86222435-86222457 GAGCAGTGGGTCAGGTGGGGAGG + Intronic
1077087725 11:763002-763024 GTCTATTGTGTCATGTGGGTTGG + Intronic
1078536875 11:12182319-12182341 GTGTAGTGGGTCAGGGGTGGGGG + Intronic
1079256276 11:18834186-18834208 GTGCAGTGGGCAAAATGGGTGGG + Intergenic
1079707823 11:23642595-23642617 GGGTAGTGGGGGAATTGGGTGGG + Intergenic
1082660969 11:55910863-55910885 GTGTAGTGGGTTAACAAGGTAGG - Intergenic
1082720229 11:56665325-56665347 CTTTAGTGGGTCAAGTGGGTGGG + Intergenic
1083346151 11:61994076-61994098 GTGTAATGGGTTGAATGGGTTGG - Intergenic
1084482633 11:69430588-69430610 GTGAAGTGGGTCTAGTGAGTGGG - Intergenic
1086170438 11:83829888-83829910 GTATGGTGGGGCAAGTGGGGAGG - Intronic
1087614762 11:100475226-100475248 GTATAGTGGGGCATGAGGGTTGG - Intergenic
1089660856 11:119984064-119984086 GTGGGGCGGGGCAAGTGGGTAGG - Intergenic
1091497948 12:988951-988973 GTGTAGTTGGGCAAGTTGGCAGG - Intronic
1091516868 12:1193257-1193279 TTGCAGTGGGTCAAGAGAGTAGG - Intronic
1093279027 12:17167877-17167899 GTGTAGTGAGTTTAGTGTGTAGG + Intergenic
1094050099 12:26210183-26210205 GTGTAGTGTGTGTAGTGTGTGGG - Intronic
1096018048 12:48296398-48296420 GTGTAGGTGGGAAAGTGGGTGGG - Intergenic
1102749097 12:115276782-115276804 GTGGTGAGGGTCAAGTGGGAAGG - Intergenic
1102918244 12:116771744-116771766 ATGTGGTGGGGCAAGTGGGGAGG + Intronic
1104490094 12:129186463-129186485 GTATAGAGGGTCAAGTGGGGAGG - Intronic
1109158828 13:58946626-58946648 GAGTAGTTGGGCAAGTGAGTTGG + Intergenic
1111008151 13:82276456-82276478 GTGCAGTGGGTCAAGTGCCGTGG - Intergenic
1112387257 13:98951459-98951481 GTGTAGGTGGGCAGGTGGGTGGG + Intronic
1112585600 13:100716152-100716174 GTGTAGGGGGTTGAGTGGGTGGG - Intergenic
1115141217 14:30173618-30173640 GTGTAGTGGAGGAAGTGGGGAGG - Intronic
1115406371 14:33021583-33021605 GTTTAGAGGGGCAAGGGGGTGGG - Intronic
1115866240 14:37750257-37750279 GTCTAGTGCTTCAAGTTGGTTGG - Intronic
1116266930 14:42704148-42704170 GTGAGGGAGGTCAAGTGGGTAGG + Intergenic
1117096649 14:52305320-52305342 GTTTAGTGGGTCAATTATGTTGG - Intergenic
1117983968 14:61369006-61369028 GTGTACTTGGTCATGTGGCTTGG + Intronic
1119601501 14:75979947-75979969 GTCTCGTGGGTCACGTGGGTGGG + Intronic
1121212509 14:92219254-92219276 GGGTAGTGGGGGAAGGGGGTAGG + Intergenic
1121586728 14:95067927-95067949 ATGTAGTGGGGAAATTGGGTGGG - Intergenic
1123149010 14:106163671-106163693 CTGAAGTGGGTCAGGTGTGTAGG - Intergenic
1124071016 15:26393305-26393327 GTGGAGTGGGACAAGTGGAATGG + Intergenic
1125019857 15:34973776-34973798 GAGTAGTATGTCAAATGGGTTGG + Intergenic
1127577253 15:60303728-60303750 GGGTAGTGGGAGAAGTGGGGAGG - Intergenic
1130295682 15:82646298-82646320 GGGAAGAGGGGCAAGTGGGTGGG - Intronic
1136681214 16:31963909-31963931 CTGAAGTGGGTCAGGTGTGTAGG + Intergenic
1136781525 16:32905421-32905443 CTGAAGTGGGTCAGGTGTGTAGG + Intergenic
1136888268 16:33948419-33948441 CTGAAGTGGGTCAGGTGTGTAGG - Intergenic
1137049950 16:35700635-35700657 GTGGAGTGGGTGGAGGGGGTAGG + Intergenic
1138202955 16:55103756-55103778 GTGGAGTGAGAGAAGTGGGTTGG - Intergenic
1140450219 16:75064698-75064720 ATGGAGTGGGGCAAGTGAGTAGG - Intronic
1140796148 16:78440270-78440292 GTATGGTGGGTCAAGTGGATGGG - Intronic
1203084180 16_KI270728v1_random:1169403-1169425 CTGAAGTGGGTCAGGTGTGTAGG + Intergenic
1147487156 17:40827501-40827523 GTGTAGCAGGGTAAGTGGGTGGG + Intronic
1148104568 17:45112490-45112512 GCTGAGTGGGCCAAGTGGGTGGG + Exonic
1157676109 18:49569769-49569791 GTGCTGTGGGTGAAGTGGGGTGG + Intronic
1157791232 18:50532996-50533018 GTGAAGTGGGTCAGATGGGGTGG + Intergenic
1160804767 19:987686-987708 GTGCAGAGGGGCATGTGGGTAGG + Intronic
1163612940 19:18310412-18310434 GTGTGGTGGGTGAAGAGGGGCGG + Intronic
1164480137 19:28605267-28605289 GCCTAGAGGGTCAGGTGGGTGGG - Intergenic
1166892032 19:45999816-45999838 GAGAAGTGGGTCAGGTGTGTGGG + Intronic
1167462174 19:49631300-49631322 GAGTGGTGGGGCAAGAGGGTGGG - Intergenic
1167711758 19:51115944-51115966 GTGTAGGAGGTGAAGTGGGGTGG - Intergenic
925988074 2:9231873-9231895 GTCCGCTGGGTCAAGTGGGTGGG - Intronic
926217686 2:10915414-10915436 CTGCAGTGGGGCAAGTGTGTGGG + Intergenic
927997877 2:27498919-27498941 GTGAAGTGGGCCAAGTGTGAGGG - Intronic
932343524 2:70981366-70981388 GTGTAGGGGGTAAAGCAGGTAGG + Intronic
932436265 2:71704112-71704134 GTGGACTGGATCAACTGGGTGGG - Intergenic
932818986 2:74883449-74883471 GTGGAGAGGGTCATGTAGGTGGG + Intronic
933061396 2:77741271-77741293 GTGTAATGGCTCAAATGGGATGG + Intergenic
937792744 2:125979745-125979767 GTGTACTGGGGCAAGTGGAAAGG + Intergenic
941105779 2:161351147-161351169 GTGTAGTGACTCAAGGGGATGGG + Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948753839 2:240147400-240147422 GTGGTGTGTGTTAAGTGGGTGGG + Intergenic
948996880 2:241585386-241585408 GTGTGGGGGGTCATGTGGGGTGG + Intronic
1169116700 20:3071213-3071235 GCGTGGTGGGCCAAGAGGGTGGG + Intergenic
1170075607 20:12415517-12415539 GTTTAGTGGGTGAAGTAGGCAGG - Intergenic
1170350470 20:15435494-15435516 ATGGAGTGGGTAGAGTGGGTAGG - Intronic
1174677923 20:52376164-52376186 GTGCTGGGGGTGAAGTGGGTTGG - Intergenic
1177540757 21:22491525-22491547 GTGTACTGGGTCAGGTGGGGTGG + Intergenic
1182560436 22:31154966-31154988 GGGTAGTGGGTGGGGTGGGTGGG - Intergenic
1182904245 22:33921833-33921855 GAGAAGTGGGTGAAATGGGTCGG + Intronic
1183945524 22:41323734-41323756 GTGAATTGGGACAGGTGGGTTGG + Intronic
1184541532 22:45128821-45128843 GTAAAGTGGGTAATGTGGGTGGG - Intergenic
1185047132 22:48534173-48534195 GTGAGGTGGGTCAAGCAGGTGGG + Intronic
953215821 3:40917183-40917205 TTTTTGTGGGTGAAGTGGGTAGG - Intergenic
955339230 3:58112166-58112188 GTGTAGACAGTGAAGTGGGTCGG - Exonic
960142231 3:114162257-114162279 CTGGAATGGGTCATGTGGGTTGG - Intronic
961383332 3:126509878-126509900 GTGGAGTGTGCCAAGTGGGGAGG - Intronic
962552874 3:136513070-136513092 GTGTAGTGGCCCAAGTGGCGGGG + Intronic
966296246 3:178427315-178427337 CAGCAGTGGGTCAGGTGGGTAGG + Intronic
970681568 4:18514560-18514582 GTGGGGTGGGGCAAGTGGGGAGG - Intergenic
980688534 4:136261139-136261161 GTGCAGTGGGTCAAGGGTGGAGG - Intergenic
981651707 4:147067377-147067399 TTGGAGTGGGTAAGGTGGGTTGG - Intergenic
982602565 4:157470220-157470242 GTCTAGAGGGTCTAGAGGGTAGG - Intergenic
982837063 4:160131823-160131845 CTGTAGTGGGTCATTGGGGTTGG - Intergenic
983181576 4:164655062-164655084 GTGGGGTGGGGCAAGGGGGTAGG + Intergenic
983819287 4:172172782-172172804 GGGTAGTCAGTCAAATGGGTAGG - Intronic
985475186 5:74868-74890 GTGCAGTGGGACAGGTGGGATGG - Intergenic
988488233 5:31685155-31685177 GAGAAGGGGGTCAAGCGGGTAGG - Intronic
994770457 5:103974426-103974448 CGGTGGTGGGCCAAGTGGGTGGG - Intergenic
995571362 5:113485938-113485960 CTGTAGTGGGTGATGTGGTTTGG - Intronic
998102706 5:139447596-139447618 TTGTATGGGGTAAAGTGGGTGGG + Intergenic
998485127 5:142495247-142495269 GTGTAGCAGGTCAAGTGTGGTGG - Intergenic
1002024152 5:176385415-176385437 GTGTGGTGGGTCTTGTGGCTTGG - Intronic
1005860030 6:29893239-29893261 GTGTTATGGGTCCAGTGGTTAGG + Intergenic
1005867634 6:29948145-29948167 GTGTTATGGGTCCAGTGGTTAGG + Intergenic
1006283871 6:33078332-33078354 GGGGAGTGGGTAAAGTGGGCAGG + Intronic
1008195648 6:48516908-48516930 GTGGAGTGGGGGAAGTGGGGAGG - Intergenic
1022099669 7:27161619-27161641 GTGGAGTGGGGGAAGGGGGTCGG + Intergenic
1023392870 7:39727409-39727431 GAGTAGTGGGGAATGTGGGTGGG - Intergenic
1024832594 7:53478961-53478983 TTGTAGTGGATCACATGGGTGGG - Intergenic
1028950042 7:96624402-96624424 GTGTAGTGGGTCAAGTGGGTCGG + Intronic
1034870942 7:154683419-154683441 GTATAGTGGATCAAGCCGGTGGG - Intronic
1035036288 7:155897392-155897414 GTTTATTGGTTCAAGTAGGTGGG + Intergenic
1036744032 8:11391351-11391373 ATGGAGTGGGTCCTGTGGGTGGG - Intronic
1038547939 8:28440379-28440401 GTTTGGTGGGTCCAGTGGCTGGG - Intronic
1040579747 8:48688176-48688198 GTGTAGTGGGGGTAGTAGGTGGG + Intergenic
1042576986 8:70231726-70231748 GTGTAGTGGGGATAGTAGGTGGG + Intronic
1051272942 9:15372598-15372620 GTGTGGTGGGTTAAGTGTGCTGG - Intergenic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1052674043 9:31596357-31596379 GTGTAGTGGGTCATATTGCTGGG + Intergenic
1056176975 9:84045101-84045123 CAGTAGTGGGTCAGGTTGGTGGG + Intergenic
1057971100 9:99558505-99558527 GAGGAGTGGGTGGAGTGGGTGGG + Intergenic
1058772393 9:108248261-108248283 ATGGAGTGTGTGAAGTGGGTTGG - Intergenic
1061246001 9:129401566-129401588 CAGTAGTGGGGCAAGGGGGTGGG + Intergenic
1061954001 9:133952200-133952222 GTGTAATGGGTTGAATGGGTGGG + Intronic
1062310039 9:135930498-135930520 CTGTAGTGGCCCAAGTGGCTGGG + Intergenic
1062418955 9:136469847-136469869 ATGTAGGGGGACAAGTGGGCCGG - Intronic
1185969601 X:4647811-4647833 GTGTAGTGGGAGGAGTTGGTGGG - Intergenic
1187810095 X:23166479-23166501 GTGTAGTGGGTGGGGTGAGTGGG + Intergenic
1192238705 X:69313234-69313256 GTGTAGAAGTGCAAGTGGGTGGG - Intergenic
1195966197 X:110432305-110432327 GTGTAGTGGTACAAGGGAGTAGG - Intronic
1201639195 Y:16160558-16160580 GCGCAGTGGGTCAAGTGAGTGGG + Intergenic
1201663618 Y:16424769-16424791 GCGCAGTGGGTCAAGTGAGTGGG - Intergenic