ID: 1028950451

View in Genome Browser
Species Human (GRCh38)
Location 7:96629850-96629872
Sequence AACCACTGCATTATTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 19, 3: 124, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028950451_1028950458 15 Left 1028950451 7:96629850-96629872 CCATGCCCAATAATGCAGTGGTT 0: 1
1: 1
2: 19
3: 124
4: 344
Right 1028950458 7:96629888-96629910 AGGTACTGCCTTGATGGTCTTGG 0: 44
1: 147
2: 292
3: 366
4: 444
1028950451_1028950454 -5 Left 1028950451 7:96629850-96629872 CCATGCCCAATAATGCAGTGGTT 0: 1
1: 1
2: 19
3: 124
4: 344
Right 1028950454 7:96629868-96629890 TGGTTCCTCCAGACTCATAGAGG 0: 1
1: 5
2: 120
3: 267
4: 430
1028950451_1028950457 9 Left 1028950451 7:96629850-96629872 CCATGCCCAATAATGCAGTGGTT 0: 1
1: 1
2: 19
3: 124
4: 344
Right 1028950457 7:96629882-96629904 TCATAGAGGTACTGCCTTGATGG 0: 34
1: 86
2: 218
3: 289
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028950451 Original CRISPR AACCACTGCATTATTGGGCA TGG (reversed) Intronic
900461825 1:2805388-2805410 CCCCACTGCATTATTGATCAAGG - Intergenic
906021186 1:42631181-42631203 AACCATAGCATTACTGGGCTTGG - Intronic
906352763 1:45078390-45078412 AACCACAGCATTACTGGGGTTGG - Intronic
907968308 1:59355525-59355547 CAACACTTCATTATTGAGCAAGG + Intronic
908302169 1:62773267-62773289 AACCACAGCATTACCGGGCTTGG - Intergenic
908598863 1:65718018-65718040 AACCCCAGCATTACTGGGCTTGG - Intergenic
909128708 1:71707929-71707951 AACCACAGCATTACTGGGCTTGG + Intronic
909309481 1:74128828-74128850 AGCCACAGCATTACTGGGCTTGG - Intronic
909667581 1:78153286-78153308 AACCACAGCATTACTGGGCTTGG - Intergenic
910230000 1:84975458-84975480 AACCACAGCATTACTAGGCTTGG + Intronic
910289923 1:85589609-85589631 AACCACAGCATTCTTGGGGTTGG + Intergenic
910330765 1:86069789-86069811 AACCACAGCGATATTGGGCTTGG + Intronic
910379143 1:86608010-86608032 AACCACAGCATAACTGGGCTTGG - Intergenic
911241253 1:95470232-95470254 AACCACAACATTACTGGGCTTGG - Intergenic
911343858 1:96673557-96673579 AACCACAGCATTACTGTGCTTGG - Intergenic
911938993 1:104018568-104018590 AAACACCGCAGTAATGGGCATGG - Intergenic
912099789 1:106190982-106191004 AACCACAGCATTACTGTGCTGGG + Intergenic
912237188 1:107864987-107865009 AACCAGTGCAGTGTGGGGCAGGG - Intronic
912242795 1:107928190-107928212 AACCACAGCATTACTGGGTTTGG + Intronic
912871709 1:113312361-113312383 AACCACAGCGTTACTGGGCTTGG + Intergenic
913707041 1:121435273-121435295 AACCACAGCATTACTGGGCTTGG + Intergenic
915895805 1:159809792-159809814 AGCCACTGCATGACTGAGCATGG + Intronic
916341701 1:163744439-163744461 AACCACAGAATGATTGGGCTTGG - Intergenic
917226289 1:172787669-172787691 AACCACAGCATTACTGGGCTTGG - Intergenic
917324811 1:173821665-173821687 AACCTCTGGATTATTGTGCTGGG - Intronic
919129820 1:193437997-193438019 AACCACAGTGTTATTGGGCTTGG - Intergenic
920492795 1:206430627-206430649 AATCACTGCAACATTGGGAAAGG - Intronic
920745051 1:208618072-208618094 AATCACAGCATTATTGGGCCTGG + Intergenic
921042726 1:211449036-211449058 AACCACAGCATTACTGGCCTTGG + Intergenic
923897614 1:238290089-238290111 TACCACTGCATTCATGGGAAAGG - Intergenic
1064202443 10:13296279-13296301 AACAAGTGCATTAGTGGGCCGGG + Intronic
1064990692 10:21254415-21254437 AACAATTACATTATTGGGCCAGG - Intergenic
1065381390 10:25095234-25095256 AACCACAGCATTACTGGGCTTGG - Intergenic
1066142855 10:32525728-32525750 AAATACAGCATTATTGGGCTTGG - Intronic
1068422030 10:56807348-56807370 AAGCACAGCATTACTGGGCTTGG - Intergenic
1069275839 10:66589366-66589388 ACCAACTCCCTTATTGGGCATGG - Intronic
1069343616 10:67440761-67440783 AACCACAGCATTATTGGGCCTGG + Intronic
1070622773 10:78026530-78026552 AAGCACTTCAGGATTGGGCAGGG - Intronic
1070897788 10:79999866-79999888 AACCACAGCATAGCTGGGCATGG - Intergenic
1071050996 10:81449273-81449295 AACCACAGAATTACTGGGCTTGG - Intergenic
1071197101 10:83174708-83174730 AACCACTGCATTACTGGGTTTGG - Intergenic
1072083739 10:92057871-92057893 AACCACAGCATTACTGGGCATGG + Intronic
1072093943 10:92158752-92158774 AAGCACTGTATTATTAAGCATGG - Intronic
1072115485 10:92366592-92366614 AACCACAGCATTACTGGGCTTGG - Intergenic
1072396753 10:95050693-95050715 AACCACTGCATTATTGGGCTTGG + Intronic
1072810925 10:98461169-98461191 ATTCACTGCTCTATTGGGCATGG - Intronic
1072853610 10:98924084-98924106 ACCCACCGTATTATTGGGCTTGG - Intronic
1074038066 10:109761156-109761178 ACCCACAGCATTACTGGGCTTGG - Intergenic
1075172987 10:120133179-120133201 ACCTACAGCATTATTGGGAATGG + Intergenic
1075789445 10:125073101-125073123 AGACACTGATTTATTGGGCAGGG - Intronic
1075888138 10:125920031-125920053 AACCTCTGTATTATTAGACAGGG - Intronic
1077375092 11:2202058-2202080 AGACATTGCATTTTTGGGCAGGG - Intergenic
1077740551 11:4840602-4840624 AAGCACAGCATTACTGGGCTTGG + Intronic
1079415990 11:20237278-20237300 AACCACAGCATTTTGGGGCTTGG - Intergenic
1080128706 11:28767514-28767536 AGCCACAGCATTACTGGGCCGGG + Intergenic
1080351262 11:31387525-31387547 AGCCACAGCATTACTGGGCTTGG + Intronic
1081590995 11:44423131-44423153 AACCACTGCAATTTTTGGCTGGG + Intergenic
1082953911 11:58848126-58848148 AACCACAGTATTACTGGGCTTGG + Intronic
1082970329 11:59013371-59013393 AACCACAGTATTACTGGGCTTGG + Intronic
1085223579 11:74896853-74896875 AATCACAGCATTATTGGGCTTGG + Intronic
1086007119 11:82049643-82049665 AACCACAGCATTACAGGGCTTGG + Intergenic
1087299442 11:96414541-96414563 AACCACAGCATTACTGGGCTTGG + Intronic
1087377828 11:97366704-97366726 AACCACAGCATTACTGAGCTTGG + Intergenic
1087492253 11:98844015-98844037 AACCACAGCATTACAGGGCTTGG - Intergenic
1087532814 11:99406264-99406286 AACCACAGCATTATTGGGCTTGG - Intronic
1087867506 11:103248992-103249014 AAAGACAGCATGATTGGGCAAGG - Intronic
1087887691 11:103498636-103498658 AAACACAGCATTATTGGGCTTGG + Intergenic
1088154713 11:106789722-106789744 AACCACAGCATTACTGGGCTTGG - Intronic
1088361892 11:109000431-109000453 AACCACAGCATTACTGGGCTTGG - Intergenic
1088985329 11:114900468-114900490 AACCACACCATTACTGTGCATGG + Intergenic
1089578719 11:119468176-119468198 AGCTACAGCATTATTGGGCTTGG - Intergenic
1089946643 11:122480585-122480607 AACCACAGCATTATTGTACTTGG + Intergenic
1090065805 11:123502415-123502437 AGCCACCGGATTAATGGGCAAGG - Intergenic
1090111333 11:123911959-123911981 AAGCACAGCATTATTAGGCGTGG + Intergenic
1091967065 12:4753901-4753923 AACCACAGCATTACTGGGCTTGG - Intronic
1092014705 12:5149204-5149226 AAGAACTGCTTTATTTGGCAGGG - Intergenic
1093178293 12:15938045-15938067 AACCACTGGATTATGTGCCAGGG + Intronic
1093538327 12:20248829-20248851 AACCAAAGCATTACTGGGCTTGG + Intergenic
1093617332 12:21241943-21241965 AACCTCAGCATTACTGGGCTTGG + Intergenic
1094658060 12:32440363-32440385 AACCACAGCATTACTGAGCTTGG - Intronic
1095133773 12:38572840-38572862 AACCACAGCATTACTGGGCTTGG + Intergenic
1095212659 12:39511186-39511208 AAACACAGCATTACTGGGCTTGG + Intergenic
1095227661 12:39696027-39696049 AACCACAGCATTACTGGGCCTGG + Intronic
1095588500 12:43875746-43875768 TATCACTCCATTATTGGGCCGGG + Intronic
1095860367 12:46909331-46909353 AACCACAGCATTACTGGGCTTGG + Intergenic
1096343829 12:50828072-50828094 AACCACGGCGTTATTGTGCTTGG - Intergenic
1096451184 12:51743391-51743413 AACCACAGCATTATTGGACTCGG - Intronic
1097714573 12:62953348-62953370 AACCACAGAATTATTGGGTTTGG - Intergenic
1097899136 12:64856400-64856422 AACCACAGCATTATTGGGCTTGG - Intronic
1099616239 12:84939005-84939027 AACCACAGCGTTATTAGGCTTGG + Intergenic
1101026022 12:100608086-100608108 AACCATGGCATTATTGGGTTTGG - Intronic
1101162490 12:101993550-101993572 AACCACAGCATTACTGGGCTGGG - Intronic
1102318084 12:111905890-111905912 AACCACAGCATTACTGGGCTTGG + Intergenic
1104103016 12:125633639-125633661 AAACACAGCATTACTGGGCTTGG - Intronic
1105841424 13:24256866-24256888 CACCACTGCATTGTTGGGGATGG + Intronic
1107265889 13:38553895-38553917 AACCACAGTATTACTGGGCTTGG - Intergenic
1107552076 13:41486803-41486825 AACCACCACATTACTGGGCTTGG - Intergenic
1107582269 13:41803087-41803109 AATCACAGCATTACAGGGCATGG + Intronic
1107774277 13:43822170-43822192 AACCACAGCATTATTGGGCTTGG - Intergenic
1108962047 13:56246705-56246727 AACCACAGCATTATTGGTCTTGG - Intergenic
1110486715 13:76053301-76053323 AACCACAGCATAACTGGGCTTGG + Intergenic
1110915066 13:81011379-81011401 AACTACAGCATTACTGGGCTTGG - Intergenic
1110953364 13:81521977-81521999 AAACACTACGTAATTGGGCAAGG + Intergenic
1111292059 13:86183492-86183514 AACCACAGCATCATTGGGCTTGG + Intergenic
1111513252 13:89294054-89294076 AACCACAGAATTACTGGGCTTGG - Intergenic
1112658196 13:101474849-101474871 AATCACGGCATTACTGGGCTTGG + Intronic
1114432325 14:22671982-22672004 AACCACAGTATTACTGGGCTTGG + Intergenic
1114987528 14:28249851-28249873 AACCACAGCATTACTAGGCTTGG - Intergenic
1115861322 14:37688735-37688757 TACCACAGCATTACTGGGCTTGG + Intronic
1116021508 14:39468099-39468121 AACCACAGCATTAGTGGCCTTGG - Intergenic
1116106563 14:40514831-40514853 AACCACAGAATTACTAGGCATGG + Intergenic
1116434194 14:44878014-44878036 AACCATAGCATTATTGGGCTTGG + Intergenic
1116766087 14:49071490-49071512 ATCCACAGTATTATTGGGCTTGG + Intergenic
1117161317 14:52993470-52993492 AACCATGGCATTACTGGGCTTGG - Intergenic
1117384101 14:55194064-55194086 AACCACAGCATTATTAGGCTTGG - Intergenic
1117418487 14:55519854-55519876 AACCACAGCATTATTGGGCTTGG + Intergenic
1117504347 14:56387901-56387923 AGCCACAGCATTGTTGGGCTTGG - Intergenic
1117795292 14:59387721-59387743 AGCCACAGCATTATTGGGCTTGG - Intergenic
1117813735 14:59576501-59576523 AACCAGGGCATCACTGGGCAGGG - Intronic
1118241036 14:64059390-64059412 AACCACAACATTATTAGGCTTGG - Intronic
1118431080 14:65719674-65719696 AACCACAGCATTATCGGGCTTGG - Intronic
1119096725 14:71839962-71839984 AGCCACAGCATTACTGGGCTTGG - Intergenic
1120178230 14:81317644-81317666 AACCACTGCAATGTTGGGCTCGG + Intronic
1121376080 14:93411718-93411740 AACCACAGCATTACTGGGCCTGG + Intronic
1121606350 14:95243055-95243077 AAACACTGCATAAATGGGTATGG + Intronic
1126707001 15:51415072-51415094 AGCCACAGTATTGTTGGGCATGG + Intergenic
1126716838 15:51526330-51526352 AACCACAGCATTAATGGGCTTGG + Intronic
1126734327 15:51716145-51716167 AACCACTGCCTTGCTGGGCGCGG - Intronic
1127012568 15:54645624-54645646 AACCACAGAATTACTGGGCTTGG + Intergenic
1127132787 15:55884207-55884229 AGCCACAGCATTACTGGGCTTGG + Intronic
1127971370 15:63965176-63965198 AACCACAGCATTACTGGGCTTGG - Intronic
1128911205 15:71516960-71516982 AACGGCTGCCATATTGGGCAGGG + Intronic
1130201244 15:81829098-81829120 AAGCACTGCTTTAATGAGCACGG + Intergenic
1131399752 15:92114865-92114887 CAGCTCTGCATTCTTGGGCAAGG + Intronic
1132219395 15:100093871-100093893 AACCATTGCGTGATTGGGCTTGG + Intronic
1133087894 16:3379362-3379384 AGCCACTGAATAATTAGGCAGGG - Intronic
1135879680 16:26241601-26241623 AACTACAGCATTATTGGGGTTGG + Intergenic
1135905390 16:26507306-26507328 AACCTCTGCAGCTTTGGGCAGGG - Intergenic
1136389035 16:29950697-29950719 AACCACAGTGTTATTGGGCTTGG - Intronic
1136464236 16:30430762-30430784 AACCACTGAGTTATTGGCCATGG + Intergenic
1136679340 16:31946620-31946642 AACCAGAGCATTATTGGGCTTGG + Intergenic
1138629614 16:58282748-58282770 AACCACGTCATTCTTGGCCAGGG - Exonic
1139004791 16:62557902-62557924 AGCCACAGCATTATTGGGGTTGG - Intergenic
1139123095 16:64043751-64043773 AGTCACAGCATTATTGGGCTTGG + Intergenic
1140158006 16:72454505-72454527 AACCACAGCATTACTGGTCTTGG - Intergenic
1140297772 16:73725892-73725914 AGCCACAGCATTATGGGGAAAGG + Intergenic
1141065230 16:80908700-80908722 AGCCACTGCACTCCTGGGCAGGG + Intergenic
1145069317 17:19789360-19789382 AACTACAGCATTATTGGGCTTGG + Intronic
1146242414 17:31243021-31243043 AGCCACAGCGTTATTGGGCTTGG - Intronic
1146744929 17:35320016-35320038 AGCCACAGCATTGTTGGGCTTGG - Intergenic
1148616760 17:49006572-49006594 AACCACAGCTATATGGGGCAGGG - Intronic
1149231403 17:54537891-54537913 AACCACAGCATTCCTGGGCTTGG + Intergenic
1151401959 17:73861553-73861575 GACCCCTGCTTTAATGGGCAGGG - Intergenic
1153453970 18:5260231-5260253 AACCACAGCATTGCTGGGCTTGG + Intergenic
1155282273 18:24251534-24251556 AACCACATCATTATTGGGCTTGG + Intronic
1155386104 18:25279337-25279359 AACCACTGTAGTATTGGTCATGG - Intronic
1156584495 18:38416732-38416754 AACCATTGTATTATTGGAGATGG + Intergenic
1157037592 18:43994271-43994293 AACCATTGAAATATTAGGCAGGG - Intergenic
1158431413 18:57390514-57390536 AACCACAGCCTTACTGGGCTTGG + Intergenic
1159473454 18:68886736-68886758 AACAACAGCATTATTAAGCAAGG - Intronic
1160611172 18:80086412-80086434 AACCACTGCAGGCTGGGGCAGGG - Intronic
1163225050 19:15954644-15954666 AACCACAGTGTTATTGGGCTTGG - Intergenic
1166408192 19:42538833-42538855 AACCACAGCATTCTTGGGCTTGG - Intronic
1167581982 19:50350288-50350310 AACCACAGCATTAATAGGCTTGG - Intronic
1167584682 19:50367397-50367419 AACCACAGCATTAATGGGCTTGG - Intronic
927570144 2:24152496-24152518 AACCACAGTATTATTGGGCTTGG - Intronic
928459019 2:31451932-31451954 AACCACAGCATTACTGGGCTTGG + Intergenic
930042835 2:47141513-47141535 AATCACTGCATTACTTTGCAGGG + Intronic
931343729 2:61426978-61427000 AACCACAGAATTACTGGGCTTGG + Intronic
931600723 2:64000600-64000622 AACCACAGCATTACTGGGCTTGG - Intronic
931637395 2:64352713-64352735 AACCACAGCATTGCTGGGCTTGG + Intergenic
933162977 2:79045938-79045960 AACCACAGTATTACTGGGCTTGG + Intergenic
933227453 2:79767563-79767585 AATCACAGCATTACTGGGCTTGG - Intronic
934125204 2:88881775-88881797 CTCCACTGCATTTTTGGGGATGG + Intergenic
935989579 2:108706680-108706702 AGTCACAGCATTATTGGGCTTGG + Intergenic
936767763 2:115874316-115874338 AACCATTGCATCCTTGGGAAAGG + Intergenic
936941547 2:117889431-117889453 TACCACTGCAGTATTGAGCAGGG - Intergenic
937512628 2:122612672-122612694 AACCACAGCATTACTGGGCTTGG + Intergenic
937613463 2:123892446-123892468 AACTACAGCATTATTGGTCTTGG - Intergenic
938177816 2:129152533-129152555 AACCACAGCTTTATTGGGGTTGG - Intergenic
939144645 2:138397275-138397297 AACCACAGCATTACTGGGCTTGG + Intergenic
939244688 2:139609067-139609089 AACCACAGCAGTACTGGGCTTGG - Intergenic
940429653 2:153575082-153575104 AACCAGAGCATTACTGGGCTTGG - Intergenic
940560455 2:155288569-155288591 AACCACAGCAGTACTGGGCTGGG + Intergenic
940795526 2:158072793-158072815 AACCACAGCATTATTGATCATGG + Intronic
940947897 2:159638207-159638229 AAACACAGCATTATTGGGCTTGG + Intergenic
941678732 2:168372015-168372037 AACCACAGCATTATTGAGCTTGG + Intergenic
942352458 2:175066365-175066387 AACCACAGCATTACTGGGCTTGG + Intergenic
942391659 2:175501833-175501855 AACCACAGCATTCTTGGGCTTGG - Intergenic
943427757 2:187758390-187758412 AACCACAGTGTTACTGGGCATGG - Intergenic
943485344 2:188473001-188473023 AACCACAGCATTACTGGGCTTGG - Intronic
944760507 2:202808798-202808820 AGCCACAGCATTACTGGGCTTGG + Intronic
1172659111 20:36555303-36555325 AACCACTGCAGAATTGCCCAGGG + Intergenic
1173204088 20:40979143-40979165 AACCACAGCATTACTGGGCTTGG - Intergenic
1173603749 20:44314522-44314544 AAGAACTGCATTATAGGGCCTGG + Intergenic
1176876759 21:14136998-14137020 AACCACAGCATTACTGGGCCTGG + Intronic
1177023879 21:15896924-15896946 AACCACAGCATTACTGGGCTTGG + Intergenic
1177121820 21:17146611-17146633 AACTATAGCATTATTGGGCTTGG + Intergenic
1177212956 21:18092291-18092313 AACCACAGCATTATTAGGCTTGG + Intronic
1177578067 21:22983675-22983697 AACCACAGCATTACTGGGCTTGG + Intergenic
1177970118 21:27778482-27778504 AACCGCAGCATTATTGGGTTTGG + Intergenic
1178202792 21:30426834-30426856 TAACACTGCATTTTTGGGGAAGG + Intergenic
1179050189 21:37882434-37882456 AACCACTGCATGACTGGGCATGG + Intronic
1179166501 21:38939271-38939293 AATCAATGCATTATTAGGCATGG + Intergenic
1184937962 22:47738943-47738965 AACCACTGAAGTTTTGGGCTCGG + Intergenic
949235571 3:1805317-1805339 AACCATGGCATTATTGGCCTGGG - Intergenic
951182038 3:19669784-19669806 AACCACAACATTACTGGGCTTGG + Intergenic
951819228 3:26790357-26790379 TACCACAGCATTACTGGGCTTGG - Intergenic
952639740 3:35579408-35579430 AACCACAGTATGATAGGGCATGG + Intergenic
952811757 3:37410772-37410794 AGCCACAGCATTACTGGGCTTGG - Intronic
955936406 3:64106995-64107017 AAAGCCTGCATTATTTGGCAGGG - Intronic
957810313 3:85214155-85214177 AGCCACAGCATTACTGGGCCTGG - Intronic
958559964 3:95735180-95735202 AATGACTGTATTCTTGGGCAAGG + Intergenic
958631078 3:96685010-96685032 AACCACAGCATGATTGGGCTTGG - Intergenic
959408937 3:105996979-105997001 AACCACAGCATTACTGGGCTTGG - Intergenic
959717857 3:109453088-109453110 CTCCACTGCATTTTTGGGGATGG + Intergenic
960088699 3:113616981-113617003 AAAAATTTCATTATTGGGCAGGG - Intronic
960153416 3:114274224-114274246 AGCCACAGCATTACTGGGCTTGG - Intergenic
961645601 3:128391230-128391252 AGCCACTGCTTTAGAGGGCAAGG - Intronic
962078607 3:132113743-132113765 AACTACAGCATTACTGGGCTGGG - Intronic
962483459 3:135817392-135817414 AACCATGGCATTATTGGGTTTGG + Intergenic
963179568 3:142339354-142339376 AACCACAGAATTATTGGTCTAGG + Intronic
963330656 3:143910919-143910941 AGCCACAGCATTATTGGGCTTGG + Intergenic
963591913 3:147270576-147270598 AACCACAGCATTATTGGGCTGGG + Intergenic
963692386 3:148520162-148520184 AACCACAGCATTACTGGGTTTGG + Intergenic
964339111 3:155689241-155689263 AAACACAGCATTATTGGACTTGG + Intronic
964383957 3:156127530-156127552 GACCACTGAATGATTGGGCTAGG + Intronic
964582775 3:158259298-158259320 AGCCACAGCATTACTGGGCTTGG - Intronic
964871815 3:161320588-161320610 AACCACAGCCTTACTGGGCTTGG + Intergenic
965059884 3:163772407-163772429 AACCACAGAATTACTGGGCTTGG - Intergenic
965118200 3:164519327-164519349 AACCTCAGCATTACTGGGCTTGG - Intergenic
965358823 3:167710984-167711006 AACCACAGCATTATTGAGCTTGG + Intronic
966401075 3:179547240-179547262 AACCACAGCATTAATGGGCTTGG + Intergenic
968004852 3:195235746-195235768 AACCACGGCATTGCTGGGCTTGG - Intronic
970011128 4:11460126-11460148 AAACACTGCATTACTGGGCTTGG + Intergenic
972020570 4:34308489-34308511 AGCCTCTGCATTATTGAGCTGGG - Intergenic
972207903 4:36799594-36799616 AACCATAGCATTAGTGGGCTTGG + Intergenic
972278311 4:37580493-37580515 AACCATAGCATTACTGGGCTTGG - Intronic
972851739 4:43058179-43058201 AACCACAGCATTACTGAGCTTGG + Intergenic
972856654 4:43114951-43114973 AACTACAGCATTACTGGGCTCGG + Intergenic
972904584 4:43728946-43728968 AATCACAGCATTATTGGGTTTGG + Intergenic
973054040 4:45631407-45631429 AGTCACAGCATTATTGGGCTTGG + Intergenic
974414855 4:61594484-61594506 AACCACAACATTATTGGGTTTGG - Intronic
975463422 4:74682545-74682567 AGCCACTGCATTATTGGGTTTGG - Intergenic
975629896 4:76388932-76388954 AACCATAGCATTATTGGGCTTGG + Intronic
976016541 4:80561241-80561263 AACCACAGCATTACTGGACTTGG + Intronic
976082692 4:81374599-81374621 AACCACAGCATTACTAGGCTTGG - Intergenic
976098810 4:81538428-81538450 TACCACTCCATTATAGGGAAAGG - Intronic
976610023 4:87020771-87020793 AAACATGGCATTACTGGGCATGG - Intronic
977396939 4:96483490-96483512 AACCTCAGCATTACTGGGCCTGG - Intergenic
977680152 4:99789864-99789886 AGCCACAGCATTACTGGGCTTGG - Intergenic
979073337 4:116240220-116240242 AACCACAGCATTACTGGGCTTGG - Intergenic
979395169 4:120178689-120178711 AACCACAGAATTACTGGGCTTGG + Intergenic
979396848 4:120198717-120198739 AACCACAGCGTTCTTGGGCTTGG + Intergenic
979482185 4:121232262-121232284 AACCAATGCATTATTCTCCAGGG + Intergenic
980172294 4:129305074-129305096 AACCATAGCATTATTGGGTTTGG - Intergenic
980686964 4:136241096-136241118 AACCACAGCATTACTGGACCCGG + Intergenic
982683255 4:158458480-158458502 AACCAGAGCGTTATTGGGCATGG - Intronic
983586501 4:169361269-169361291 AACCACAGCATTATTGGGCTTGG - Intergenic
983896360 4:173085558-173085580 AACCACTGAAGTATTGGGGAGGG - Intergenic
983931909 4:173461489-173461511 AACCACAGCATTACTGCGCTTGG + Intergenic
987164100 5:15175152-15175174 AACCACAGCATTACTGGGTGTGG + Intergenic
987823232 5:22992327-22992349 AACCACAGCGTTACTGGGCTTGG + Intergenic
988039722 5:25874005-25874027 AATCACTGCATTACTGGGCTTGG - Intergenic
988123855 5:27003279-27003301 AACCAATAGATAATTGGGCAAGG + Intronic
988939483 5:36128184-36128206 AACCACAGCATTATAGGGCTTGG + Intronic
989629103 5:43462210-43462232 AACCACAGCATTACTGGGCTTGG + Intronic
989970625 5:50520624-50520646 AGCCACAGCATTAATGGGCTTGG - Intergenic
990593024 5:57284470-57284492 AACCACTGTGTTACTGGGCTTGG + Intergenic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
992587316 5:78253362-78253384 AACCACAGCATTATTGGGCTTGG + Intronic
992692575 5:79255649-79255671 AACCACAGCAATATTGGGCTTGG - Intronic
992934657 5:81688689-81688711 AACCACAGCTTTATTGGGTTTGG + Intronic
993197124 5:84763893-84763915 AACCACAGCGTTACTGGGCTTGG - Intergenic
994226350 5:97255179-97255201 AATCACAGCATTACTGGGCTTGG + Intergenic
994235485 5:97357822-97357844 AACCACAGCGTTATTGGGCTTGG - Intergenic
996988843 5:129603540-129603562 AACCCTTGCATTATTGTGTATGG + Intronic
998462958 5:142323129-142323151 CACCAGTGCAATATTGGGTAGGG + Intronic
999345777 5:150817725-150817747 AACCACAGCATTACTGGGCTTGG + Intergenic
999641460 5:153677279-153677301 AACCACTGCATTGTTGGTGTTGG + Intronic
1000478510 5:161743387-161743409 AACCACAGCATTACTGGGCTTGG - Intergenic
1000651200 5:163821352-163821374 AACCACAGCATTATTGGGCTTGG - Intergenic
1001177789 5:169487687-169487709 AATCACAGCATTACTGGGCTTGG + Intergenic
1001814462 5:174656504-174656526 AACAAATACATTATTGGGCCTGG - Intergenic
1003262005 6:4525952-4525974 AACCACAGTATTGTTGGGCTTGG + Intergenic
1005862664 6:29913407-29913429 AACCCCGTCATTATTGTGCAGGG - Intergenic
1008312333 6:49990969-49990991 AACCACAGCATTACTGGGCTTGG + Intergenic
1008731653 6:54490737-54490759 AACCATAGCATTATTGGGCTTGG - Intergenic
1009390827 6:63141148-63141170 AACCACAGCATTACTGGGCTTGG + Intergenic
1010182046 6:73097790-73097812 AACCATAGCATTACTGGGCTTGG + Intronic
1010299375 6:74242798-74242820 AACCACAGCATTATTGGGCTCGG - Intergenic
1010474774 6:76274161-76274183 AAACACAGCATTATTGGGCATGG - Intergenic
1010502316 6:76615826-76615848 AACCACAGCATTACTGGGTTTGG + Intergenic
1010625426 6:78132286-78132308 AACCACAGCATTACTGAGCTTGG + Intergenic
1010772618 6:79848545-79848567 AACCACAACACTATTTGGCATGG + Intergenic
1011019093 6:82790185-82790207 AAGCACAGCATTACTGGGCTTGG + Intergenic
1011322717 6:86115161-86115183 AACCACAGCATTACTGGGCTTGG - Intergenic
1011901466 6:92302986-92303008 AACCACAGCATTACTGGGTATGG + Intergenic
1012003734 6:93685877-93685899 AACCACAGCATTGTTGGACTTGG + Intergenic
1012028737 6:94030542-94030564 AACCACAGCATTATTGGACTTGG + Intergenic
1012091580 6:94903706-94903728 AACCACAGCATTACTAGGTATGG + Intergenic
1012901867 6:105015776-105015798 AACCACTACAGTATCTGGCATGG - Intronic
1012940607 6:105410588-105410610 AACCACTGTGATATTGGGCTTGG + Intergenic
1013282648 6:108653249-108653271 AACCATTGAATTAATGGGAAGGG - Intronic
1014692557 6:124579016-124579038 AGCCACAGCATTATTGAGCTTGG + Intronic
1015143101 6:129958054-129958076 CACCCTTGCATGATTGGGCAGGG + Intergenic
1015959582 6:138632639-138632661 AACCACAGTATTACTGGGCTTGG + Intronic
1016136755 6:140554133-140554155 AACCACAGCATTACTGGGCTTGG - Intergenic
1016230953 6:141803569-141803591 AATCACAGCATTACTGGGCTTGG - Intergenic
1016457238 6:144244354-144244376 AACCACGGGATTATTGGGCTTGG - Intergenic
1016565502 6:145448387-145448409 AACCATTGCTTTAAAGGGCAGGG + Intergenic
1017318730 6:153063001-153063023 AACCACAGCATTACTGGGCTCGG + Intronic
1017539479 6:155385486-155385508 AACTACAGCAGTATGGGGCAGGG - Intergenic
1017924686 6:158900932-158900954 AACAACTACATTATTGGGCTTGG - Intronic
1018316724 6:162563442-162563464 AACCACAGCATTACTGGGCTTGG + Intronic
1019044515 6:169132780-169132802 AACCACAGCATTATTGGGCTTGG + Intergenic
1020329646 7:7004534-7004556 ATCTATTGCATTATGGGGCATGG + Intergenic
1021046272 7:15926064-15926086 AACCACAGCATTACTGGGCTTGG + Intergenic
1021382286 7:19983016-19983038 AACCACAGCATTACTGGGCTTGG - Intergenic
1021969146 7:25950648-25950670 AAGCACTGCCTAATGGGGCAGGG - Intergenic
1022541894 7:31145533-31145555 AACCACAGCATTACTGGGTTTGG - Intergenic
1022609912 7:31860207-31860229 AACCAGTGGTTTATTTGGCAAGG + Intronic
1023139757 7:37090274-37090296 AACTGCTGCATTATTAGGCCAGG + Intronic
1023643219 7:42282507-42282529 ACCCACTGATTTAATGGGCATGG - Intergenic
1023716388 7:43047895-43047917 ACCCACAGCATTACTGGGCTTGG + Intergenic
1024580821 7:50799406-50799428 AATCACTGCAGTATTGGTCTAGG - Intergenic
1024891796 7:54211791-54211813 AACCACAGCATTACTGGGCTTGG + Intergenic
1025050284 7:55728478-55728500 CACCACTGCATAATTGGCCTGGG + Intergenic
1025926635 7:65965813-65965835 AACCTCTGCAGTGCTGGGCATGG - Intronic
1027808377 7:82859531-82859553 AACCACAGCATTACTGGGCTTGG + Intronic
1028186374 7:87790305-87790327 AACCACAGTGTTATTGGGCTTGG + Intronic
1028591554 7:92501442-92501464 AACCACTGTATTATTGGCTTTGG - Intronic
1028797115 7:94915737-94915759 AACCACATCATTAATGGGGAAGG - Intronic
1028929404 7:96396845-96396867 AACCACAGCATTACTGTGCTTGG - Intergenic
1028950451 7:96629850-96629872 AACCACTGCATTATTGGGCATGG - Intronic
1029797166 7:102908622-102908644 AACCACAGCATTACTGGGCTTGG - Intronic
1030201254 7:106907405-106907427 AAACATTTCATTATAGGGCATGG - Intergenic
1030370364 7:108693368-108693390 AACCACAGCATTCCTGGGCTTGG - Intergenic
1030488538 7:110203279-110203301 AACCACAGCATTACTAGGCTTGG - Intergenic
1030881140 7:114881931-114881953 AACCACAGCATTATTAGGCCTGG - Intergenic
1030990447 7:116292459-116292481 AGCCACAGCATTACTGGGCTTGG + Intronic
1031546041 7:123052731-123052753 AACCACAGCATTACTGGGCTTGG - Intergenic
1033219996 7:139521440-139521462 AATCTCTGCATTATTGAGCGTGG + Intergenic
1033489101 7:141824339-141824361 AAACACAGCATTACTGGGCTTGG - Intergenic
1033500020 7:141937952-141937974 ACCCACAGCATTACTGGGCTTGG + Intronic
1033867657 7:145712847-145712869 AACCACAGCATTACTGGGCTTGG - Intergenic
1033887371 7:145964686-145964708 AACCACAGCATTACTGGACTTGG + Intergenic
1034019020 7:147620106-147620128 AAACACAGCATTACTGGGCTTGG + Intronic
1034126542 7:148676472-148676494 AGCCTCAGCATTATTGGGCTTGG + Intergenic
1034521354 7:151622932-151622954 GACCACTGCATTAGAGGGCCTGG - Intronic
1035084397 7:156246138-156246160 AACCACAGCATTACTGGGCTTGG - Intergenic
1037254948 8:16942587-16942609 AACCACAGCAATATTGGGCTTGG + Intergenic
1038871770 8:31503243-31503265 AACCACAGCATTACTGGGCTTGG - Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042162762 8:65913290-65913312 AACCATAGCATTACTGGGCTTGG + Intergenic
1042898502 8:73696198-73696220 AGCCACAGCATTGTTGGGCTTGG + Intronic
1042980382 8:74519651-74519673 AACCACAGCATTAATGGGCTTGG + Intergenic
1043221264 8:77668114-77668136 AATCACTGCATTAATGCTCATGG + Intergenic
1043366966 8:79543800-79543822 AACCACAGTATTACTGGGCTTGG + Intergenic
1044026106 8:87174791-87174813 AACCACAGCATTACTGGGCTTGG - Intronic
1044395096 8:91702323-91702345 AACCACAGCATTACTGGGCTTGG - Intergenic
1045041170 8:98226447-98226469 AACTACAGCATTACTGGGCTTGG - Intronic
1045621352 8:103981360-103981382 AAACACAGCATTATTGGGCTTGG + Intronic
1045733275 8:105266481-105266503 AACCACAGTATTATTGGGCTTGG - Intronic
1045777323 8:105821372-105821394 AACTACAGCATTACTGGGCTTGG - Intergenic
1046169533 8:110486496-110486518 AACCACAGCATTATTGGGCTTGG + Intergenic
1046268065 8:111858034-111858056 AACCACAGCATTACTAGGCTTGG - Intergenic
1046920578 8:119723938-119723960 AAGCACAACATTGTTGGGCATGG + Intergenic
1047901224 8:129423985-129424007 AACCACAGCATTGTTGGGCTGGG + Intergenic
1048008947 8:130441432-130441454 AACCACTGCTGTATCTGGCATGG - Intronic
1050121856 9:2316440-2316462 AACCACAGCATTACTGAGCTTGG - Intergenic
1050238714 9:3612199-3612221 AGCCACAGCATTACTGGGCTTGG - Intergenic
1050248301 9:3714535-3714557 AACCACACTATTATTGGGCTTGG + Intergenic
1050439119 9:5642105-5642127 AACCTCAGCATTATTGGGCTTGG - Intronic
1051704455 9:19861365-19861387 AACCACAGCACTACTGGGCTTGG + Intergenic
1051992202 9:23164384-23164406 AAACACAGCATTATTGGGACTGG + Intergenic
1052214507 9:25950415-25950437 AACCACAGCATTACTGGACTTGG - Intergenic
1052476957 9:28972073-28972095 AACCACAGCATTACTGCGCTTGG + Intergenic
1053040196 9:34863570-34863592 AAGCACAGCATTACTGGGCATGG + Intergenic
1054982710 9:71224320-71224342 AACCACAGCATTACTGGGTTTGG + Intronic
1055243644 9:74216225-74216247 AACCACAGCATTACTGGGATTGG - Intergenic
1056184247 9:84117888-84117910 AACCACAGCATTACTGGGCTTGG - Intergenic
1056424553 9:86464187-86464209 AACCACAGCATTACTGGACTTGG - Intergenic
1058241724 9:102570215-102570237 AACCACAGTATTACTGGGCTTGG + Intergenic
1059041906 9:110823543-110823565 AGCCACAGCATTACTGGGCTTGG + Intergenic
1059587717 9:115623916-115623938 AACCACTGCTTTAGTGGGGTGGG - Intergenic
1060304626 9:122399328-122399350 AGCCACAGCATTACTGGGCTTGG + Intergenic
1062305628 9:135905485-135905507 GCCCAGTGCATTCTTGGGCATGG - Intronic
1187132912 X:16519222-16519244 AGCCACAGCATTATTGGGTTTGG + Intergenic
1187315006 X:18184575-18184597 AGCCACTGCATTACTGGACTTGG + Intronic
1187610458 X:20938259-20938281 AACCACAGCATTACTAGGCTTGG - Intergenic
1187618228 X:21021312-21021334 AGCCACAGCATTACTGGGCTTGG + Intergenic
1188068729 X:25694277-25694299 AACCACAGCATTACTGGGCTTGG - Intergenic
1188420996 X:29991073-29991095 AACCACAGCATTATTGGGCTTGG - Intergenic
1188545535 X:31301682-31301704 TACCACTGCATTTTAGGGGAAGG + Intronic
1188721394 X:33527829-33527851 AACCACAGCATTACTGGGCTTGG - Intergenic
1188815182 X:34704852-34704874 AACCACAGCATTATTGAGCTTGG - Intergenic
1189013302 X:37069849-37069871 AATGACAGCATTATTGGGCTTGG - Intergenic
1189034912 X:37485830-37485852 AACCACAGCGTTATTGGGCTTGG + Intronic
1189363422 X:40370434-40370456 AAGCACTGCCTTCTGGGGCAGGG - Intergenic
1189405867 X:40721931-40721953 AACCACAGCATTATTGAGCTTGG + Intronic
1189640929 X:43069034-43069056 AACCACAGCATCACTGGGCTTGG + Intergenic
1189854300 X:45208647-45208669 AACTACAGCATTACTGGGCTTGG - Intergenic
1189858329 X:45246964-45246986 AGCCACAGCATTACTGGGCTTGG - Intergenic
1189885001 X:45533446-45533468 AACTACAGCATTACTGGGCTTGG + Intergenic
1190015261 X:46820796-46820818 AACCACAGCATTTTTGGGCTGGG + Intergenic
1190530510 X:51369581-51369603 AACCACAGTGTTATTGGGCTTGG + Intergenic
1190919434 X:54838500-54838522 AACCACAGCATTACTAGGCTTGG - Intergenic
1191030682 X:55966536-55966558 AACTACTGCATTACTGGACCTGG + Intergenic
1191048956 X:56170114-56170136 AACCACAGCATTAGTGGACTTGG + Intergenic
1191083522 X:56538808-56538830 AACCACAGTATTACTGGTCATGG + Intergenic
1191119044 X:56884210-56884232 AACCACAGCATTATAGGGCTTGG - Intergenic
1191801058 X:65079649-65079671 AACCACTGTGTTACTGGGCTTGG + Intergenic
1191827039 X:65376696-65376718 AACCACAGTATTACTGGGCCTGG + Intronic
1191967468 X:66776108-66776130 AATCACAGTATTATTGGGCTTGG - Intergenic
1192045878 X:67674020-67674042 AGCCACAGCATTACTGAGCATGG - Intronic
1192077999 X:68019321-68019343 AACCACAGCATTACTGAGCTTGG + Intergenic
1192088171 X:68122274-68122296 AACCACAGAATTACTGGGTATGG + Intronic
1192304291 X:69943393-69943415 AGCCACAGCATTATTGGGCTTGG - Intronic
1192393527 X:70754904-70754926 AACCAGAGCATTAGTGGGCTTGG + Intronic
1192400362 X:70828048-70828070 AAACACAGCATTATTAGGCTTGG + Intronic
1192839052 X:74835483-74835505 AACCACAGAAATATTGGGCTTGG - Intronic
1193009388 X:76658976-76658998 AACCACGGCATTACTGGGTTTGG + Intergenic
1193032857 X:76918334-76918356 AACCTCTGATTTATTAGGCAGGG - Intergenic
1193063700 X:77234183-77234205 AAACATAGCATTATTGGGCTTGG + Intergenic
1193147363 X:78091792-78091814 AACCACAGCATTACTGAGCTTGG - Intronic
1193172916 X:78357616-78357638 AACCACAGCATTACTGAACATGG - Intergenic
1193219945 X:78912794-78912816 AACCACAGCATTACTGGGCTTGG - Intergenic
1193260907 X:79404937-79404959 AATCACAGCATTATTGGACTTGG + Intergenic
1193300117 X:79879521-79879543 AACCACAGCATTATGGGGTTGGG + Intergenic
1193489527 X:82132389-82132411 AACCACAGCCTTATTGGGTTTGG + Intergenic
1193585193 X:83312217-83312239 AACCACAGCATTACTGGGCTTGG + Intergenic
1193650442 X:84124114-84124136 AACCACAGCATTATTGGGCTTGG + Intronic
1193664724 X:84301011-84301033 AACCACAGCATTAGTGGCCTTGG + Intergenic
1193755775 X:85407639-85407661 AACCACAGCATTACTAGGCTTGG - Intergenic
1193765711 X:85527340-85527362 AGCCACAGCATTACTGGGCTTGG - Intergenic
1193846679 X:86480190-86480212 AACCACAGCATTATTGGGCTTGG - Intronic
1193894938 X:87101306-87101328 ACTCACAGCATTATTGGGCTTGG + Intergenic
1194033284 X:88841280-88841302 AGCCACAGCATTATTGGTCCTGG + Intergenic
1194196599 X:90902493-90902515 AACCACAGCATTATTGAGTTTGG - Intergenic
1194229376 X:91302442-91302464 AAACACAGCATTACTGGGCCTGG + Intergenic
1194285558 X:92006821-92006843 AACCACAGCATTAATGGGATTGG - Intronic
1194290964 X:92071641-92071663 AACCACAGCATTATTAGACTTGG - Intronic
1194358395 X:92917586-92917608 AACCACAGCATTAGTGTGCTTGG - Intergenic
1194437984 X:93893505-93893527 AACCACAGCATTACTGAGCTTGG - Intergenic
1194479251 X:94400424-94400446 AACTACAGCATTATTGAGCTTGG - Intergenic
1194495480 X:94612513-94612535 AACCACAGCATTACTGGGATTGG - Intergenic
1194623735 X:96203113-96203135 AACCACACCATTACTGGGCTTGG + Intergenic
1194692787 X:97008646-97008668 AGCCACAGCATTAGTGGGCTTGG - Intronic
1194791933 X:98160739-98160761 AACCACAGCATTACTGGGCTTGG + Intergenic
1194839617 X:98725125-98725147 AACTACAGCATTACTGGGCTTGG - Intergenic
1194928930 X:99862961-99862983 AATCACAGCATTACTGGGCTTGG + Intergenic
1195122816 X:101774262-101774284 AACCACAGCGTTACTGGGCTTGG - Intergenic
1195341754 X:103913516-103913538 AACCACTGGGTGATTGTGCACGG - Intergenic
1195455385 X:105063760-105063782 AACCAAAGCATTACTGGGCTTGG - Intronic
1195542946 X:106084218-106084240 AACCACAGCATTACTGGGCTAGG - Intergenic
1195782896 X:108484520-108484542 AACCACAGCACTATTGGGCTTGG - Intronic
1195821050 X:108945812-108945834 AACCACAGCATTACTGGGGTTGG - Intergenic
1195849023 X:109263525-109263547 AACCACAGCATTATTGGGTTTGG - Intergenic
1195971374 X:110477502-110477524 AACCACAGCATTACTGGGCTTGG - Intergenic
1196269950 X:113698861-113698883 AACCACAGCTTTATTGTGCTTGG - Intergenic
1196273811 X:113742894-113742916 TACCACGGCATTGTTGGGAAGGG + Intergenic
1196485493 X:116202672-116202694 AACCACAGTGTTATTGGACACGG - Intergenic
1196538845 X:116881861-116881883 AACCACAGCATTACTGGGTTTGG - Intergenic
1196600797 X:117599996-117600018 AACCACAGCATTACTGGGCTTGG - Intergenic
1197139259 X:123097610-123097632 AACCACAGCATTACTGGGCTTGG + Intergenic
1197360988 X:125503975-125503997 AACCACAGCATTACTGGGCATGG - Intergenic
1197391788 X:125877101-125877123 AACCATAGCATTACTGGGCTTGG - Intergenic
1197470110 X:126856534-126856556 AACCACAGTATTACTGGGCTTGG + Intergenic
1197600496 X:128521214-128521236 AACCACAGCATTAGTGGGATTGG + Intergenic
1197623421 X:128778266-128778288 AACCACAACAATATTGGGCTTGG - Intergenic
1197987013 X:132277846-132277868 AACCACAGCATTACTGGGCTTGG - Intergenic
1198695000 X:139325878-139325900 AACCATGGCATTATAGGGCTTGG + Intergenic
1198702434 X:139412971-139412993 AACCACAGCATTACTGGGCTGGG - Intergenic
1198720307 X:139611041-139611063 AGCCACTGTATTATTAAGCAAGG + Intronic
1199159812 X:144596154-144596176 AACCACTGTATTAATGGACCTGG - Intergenic
1199239268 X:145527165-145527187 AACCACAGCGTTACTGGCCATGG + Intergenic
1199274759 X:145927415-145927437 AATCACAGCATTACTGGGCTTGG + Intergenic
1199358429 X:146887530-146887552 ATCCACAGCATTACTGGGCTTGG + Intergenic
1199441102 X:147868132-147868154 AACCACAGCATTACTGGGTTTGG + Intergenic
1199457269 X:148043462-148043484 AGCCACAGCATTACTGGGCTTGG - Intergenic
1199645881 X:149910135-149910157 AACCACAGCATTACTGTGCTTGG + Intergenic
1200427164 Y:3034384-3034406 AACAACAGCATTACTGAGCACGG - Intergenic
1200542445 Y:4476694-4476716 AACCACAGCATTATTGAGTTTGG - Intergenic
1200603128 Y:5231359-5231381 AACCACAGCATTAATGGGATTGG - Intronic
1200608474 Y:5296216-5296238 AACCACAGCATTATTAGACTTGG - Intronic
1200666573 Y:6033277-6033299 AACCACAGCATTAGTGTGCTTGG - Intergenic
1201955985 Y:19622856-19622878 AAACACAACATTATTGGGCTTGG + Intergenic
1201980291 Y:19899900-19899922 ATCCACAGCATTCTTGGGCTTGG + Intergenic