ID: 1028951927

View in Genome Browser
Species Human (GRCh38)
Location 7:96645795-96645817
Sequence GTGACTAATAGGAGAACTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028951918_1028951927 23 Left 1028951918 7:96645749-96645771 CCATGCCGGATAGATGGATGGAT 0: 1
1: 0
2: 2
3: 12
4: 105
Right 1028951927 7:96645795-96645817 GTGACTAATAGGAGAACTAGGGG 0: 1
1: 0
2: 0
3: 10
4: 62
1028951917_1028951927 24 Left 1028951917 7:96645748-96645770 CCCATGCCGGATAGATGGATGGA 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1028951927 7:96645795-96645817 GTGACTAATAGGAGAACTAGGGG 0: 1
1: 0
2: 0
3: 10
4: 62
1028951920_1028951927 18 Left 1028951920 7:96645754-96645776 CCGGATAGATGGATGGATGGATT 0: 1
1: 1
2: 20
3: 48
4: 308
Right 1028951927 7:96645795-96645817 GTGACTAATAGGAGAACTAGGGG 0: 1
1: 0
2: 0
3: 10
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028951927 Original CRISPR GTGACTAATAGGAGAACTAG GGG Intronic
904849711 1:33448107-33448129 GACACTAACAGGAGAGCTAGAGG + Intergenic
912537682 1:110387795-110387817 GTTACTAATAGGGAAACTAAAGG - Intronic
913043705 1:115055197-115055219 GGGCCTAATGGCAGAACTAGAGG - Intronic
913060291 1:115198193-115198215 GAGACTAAAAGAAGAACTAGAGG - Intergenic
914432445 1:147631278-147631300 GTGTCTGATATGAAAACTAGGGG - Intronic
916748932 1:167706649-167706671 GTGACTAACAGGAGACTTGGGGG - Intergenic
921397642 1:214685639-214685661 GTTTCTAAAAGTAGAACTAGCGG - Intergenic
922790567 1:228308692-228308714 GGGACTAGTGTGAGAACTAGAGG - Intronic
924049380 1:240064926-240064948 GAGACTAAAAGTAGAAATAGTGG + Intronic
1065319749 10:24498323-24498345 GTGACTAAAAGGAAAAGAAGTGG + Intronic
1066596869 10:37060759-37060781 CTGAAGAATATGAGAACTAGAGG - Intergenic
1069665638 10:70155377-70155399 GTCACCAATAGGAAAGCTAGCGG + Intronic
1074296723 10:112195995-112196017 GTGACTACAAGGAAAACTAGGGG + Intronic
1088633424 11:111796031-111796053 GTGACAAATAGAAGGATTAGGGG + Intronic
1093661990 12:21767679-21767701 ATGATTAAAGGGAGAACTAGGGG + Intronic
1104080422 12:125425383-125425405 GTTAATAATAGGGGAACTGGAGG - Intronic
1104426117 12:128679526-128679548 GTGGCTTATAGGAGCACAAGTGG + Intronic
1115815352 14:37157963-37157985 GTGACAAATTGGAAAACTAGAGG + Intronic
1117851225 14:59971879-59971901 GTGAAAAATGGAAGAACTAGAGG - Intronic
1118069866 14:62234479-62234501 CTCAATAATAGGAGAACTAGTGG - Intergenic
1119144791 14:72302432-72302454 GTCACTAAAAGGAGAACTCAGGG + Intronic
1132192918 15:99884386-99884408 GTGACTTATAGGAGATCGAGTGG - Intergenic
1134222848 16:12368842-12368864 GTAACTAAAATGAGAACAAGGGG - Intronic
1135449265 16:22543488-22543510 GGGACAAATAGGATTACTAGAGG + Intergenic
1136118783 16:28115027-28115049 GGAAATAACAGGAGAACTAGAGG - Intronic
1137320202 16:47372751-47372773 GTGAGCAATAAGAGAAATAGAGG - Intronic
1139115372 16:63944903-63944925 GGGACTAATATGAGCACTGGAGG - Intergenic
1140762840 16:78126885-78126907 GTCATTAATAGAAGATCTAGGGG - Intronic
928511420 2:32007681-32007703 GTGAGTAATAGGAGATGGAGAGG - Intronic
938185948 2:129232049-129232071 GTGAGAAATAGGAGCACTCGTGG - Intergenic
943149139 2:184088513-184088535 GGGACTTATAGGAGAAACAGTGG + Intergenic
943616005 2:190093515-190093537 GTGACTTATAGCAGAAGTAGAGG + Intronic
946290762 2:218743240-218743262 ATGACAAAAAGGAGAACTAGTGG - Intronic
947747599 2:232517000-232517022 GGGAGGAAGAGGAGAACTAGGGG + Intergenic
1169129126 20:3154826-3154848 GTGAGTAAGAGGAGGAGTAGGGG + Intronic
1179233523 21:39526045-39526067 GTGACGAATAAGACAACTTGGGG + Intergenic
1181927230 22:26369646-26369668 GTTCCTAATAAGAGAACAAGGGG + Intronic
1184456496 22:44613403-44613425 GCTAAAAATAGGAGAACTAGGGG + Intergenic
1184584511 22:45438620-45438642 ATTAATAATAGGGGAACTAGGGG + Intergenic
953853473 3:46483632-46483654 GTGATTAATAGGAGCAAGAGTGG + Intronic
954420457 3:50416385-50416407 GTGGCCTATAGGAGAAATAGAGG - Intronic
954570497 3:51637088-51637110 GTCAATAATATGAGAAGTAGGGG - Intronic
963240888 3:143001421-143001443 GTGACTCCCAGGAAAACTAGCGG + Intronic
969950602 4:10831426-10831448 GTAACTAATAGAAGAACAATGGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977447613 4:97150773-97150795 ATGACTAATAAAAGAACTAGTGG - Intergenic
978385160 4:108170813-108170835 TTGACCAATAGGAAAACAAGTGG + Intergenic
984553478 4:181186765-181186787 GGGACTAATATGAAGACTAGTGG - Intergenic
984672915 4:182512521-182512543 GTCACTACTAGGAGCATTAGAGG + Intronic
985815824 5:2127034-2127056 GTTAATAATAGGAGAACAAGGGG - Intergenic
988117207 5:26910913-26910935 GCCACTAATAAGAGAAGTAGGGG + Intronic
988118503 5:26927864-26927886 GCCACTAATAAGAGAAGTAGGGG - Intronic
1006210631 6:32391045-32391067 GTTAATAATAGCAGAAATAGGGG + Intergenic
1009435629 6:63614950-63614972 GTAATTACTAGAAGAACTAGAGG - Intergenic
1011748258 6:90429096-90429118 GGGATTAATAGGAGTATTAGTGG + Intergenic
1027849847 7:83436543-83436565 GTGACTATTATGAGAATCAGAGG + Intronic
1028951927 7:96645795-96645817 GTGACTAATAGGAGAACTAGGGG + Intronic
1030611009 7:111688800-111688822 GTATCTAATATGAGCACTAGTGG - Intergenic
1033291993 7:140093382-140093404 TTCACTCAGAGGAGAACTAGAGG + Intronic
1033378799 7:140791818-140791840 GTGAAAAATATGAGAAGTAGAGG - Intronic
1034526374 7:151665948-151665970 TTTCATAATAGGAGAACTAGGGG + Intronic
1037049055 8:14346171-14346193 GTTACTAATAGGAGAAACTGGGG + Intronic
1038432712 8:27512943-27512965 CTGACAAACAGGAGAACTGGAGG + Intronic
1041871935 8:62644651-62644673 GTGACTAAAAGGTTAAGTAGTGG + Intronic
1046960207 8:120103607-120103629 GTGAGAAATAGGAGAACAATTGG + Intronic
1052520546 9:29542917-29542939 GTTAATAATAGGAGAACTGAGGG - Intergenic
1054934283 9:70670056-70670078 GTGACTAATGGGAGAAGGAGTGG + Intronic
1186367704 X:8912811-8912833 GTGATGAATAGGAGACCTGGTGG - Intergenic
1188220706 X:27538185-27538207 ATGACAAATAGGTAAACTAGAGG - Intergenic
1193652299 X:84152103-84152125 CTGAATATTAGAAGAACTAGGGG - Intronic
1197353048 X:125401067-125401089 GAGACTAATATTAGAATTAGTGG - Intergenic
1198431189 X:136567785-136567807 GTGACTAATGGCAGGAGTAGGGG - Intergenic
1199171810 X:144741922-144741944 ATGTCCATTAGGAGAACTAGTGG + Intergenic