ID: 1028957278

View in Genome Browser
Species Human (GRCh38)
Location 7:96708165-96708187
Sequence TCTACGACACAGCTCTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028957275_1028957278 -1 Left 1028957275 7:96708143-96708165 CCTACCTTCAATAGGCCAGCTTT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1028957278 7:96708165-96708187 TCTACGACACAGCTCTATGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1028957276_1028957278 -5 Left 1028957276 7:96708147-96708169 CCTTCAATAGGCCAGCTTTCTAC 0: 1
1: 0
2: 1
3: 12
4: 135
Right 1028957278 7:96708165-96708187 TCTACGACACAGCTCTATGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028957278 Original CRISPR TCTACGACACAGCTCTATGT TGG Intronic
1064191895 10:13213719-13213741 TCTACTACACATCTATCTGTAGG - Intergenic
1088752710 11:112858256-112858278 TCCACCAAAAAGCTCTATGTTGG + Intergenic
1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG + Intronic
1093301012 12:17454997-17455019 TCTAGTACAGAGCTCTATGCAGG + Intergenic
1095999120 12:48114244-48114266 TGTAGGACAGAGCTCGATGTCGG + Intronic
1097338946 12:58415925-58415947 GCTAAGACACAGTTCCATGTGGG + Intergenic
1098753300 12:74324095-74324117 TCTACCTAACAGCTCTATTTGGG - Intergenic
1102648785 12:114421607-114421629 TATAGGACACAGCTCTTTGGGGG + Intergenic
1106571758 13:30934014-30934036 TCTACCAGACAGTTCCATGTGGG + Intronic
1109202185 13:59442786-59442808 GATATCACACAGCTCTATGTGGG + Intergenic
1118878499 14:69805697-69805719 ACTAGGACACATCTCTAGGTTGG - Intergenic
1121366301 14:93314518-93314540 TATACAACACAGTTCTATGTAGG - Intronic
1130967896 15:88710642-88710664 TGGAGGACACAGCTCTATTTAGG + Intergenic
1138904115 16:61309747-61309769 TCTGCCACACTGCTCTTTGTTGG + Intergenic
1150547334 17:66173286-66173308 TCTAAGAGACAGCCATATGTTGG - Intronic
1168369124 19:55816731-55816753 TCTAGGACAGAGCTCTCTGCTGG + Intronic
927711979 2:25331852-25331874 GCTACAACCCAGCTCCATGTGGG + Intronic
928012307 2:27621301-27621323 TCTAAGACTCAGCTCTGTCTCGG - Exonic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
939218831 2:139276031-139276053 TCTAAAACACAGCTCAATGTAGG + Intergenic
1177058290 21:16337029-16337051 TCTAGGAAGCAGCTCAATGTAGG + Intergenic
1182891766 22:33825157-33825179 TCTACTACAAAGCACTATGGAGG + Intronic
952583123 3:34858305-34858327 TCTTCTACACAGTTCTGTGTTGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956111961 3:65878854-65878876 TCTACGAAACAGGTATAGGTAGG + Intronic
962733482 3:138303877-138303899 TTTTCGCCACAGCTCTATGAGGG + Intronic
978323899 4:107528940-107528962 TGTACTATACAGCTCTTTGTTGG - Intergenic
985175527 4:187195760-187195782 TGTACCAAACAGCTCTATTTAGG - Intergenic
985890474 5:2711688-2711710 TCTATGACACAGTTCACTGTAGG + Intergenic
993141302 5:84037254-84037276 TTTAGGACACAGCTTTATTTAGG - Intronic
1002159233 5:177305136-177305158 TCTATGGCACAGATATATGTTGG + Intronic
1002942519 6:1730642-1730664 CCCACCACACAGCTCTCTGTGGG + Intronic
1003340265 6:5213790-5213812 ACTAAGAGCCAGCTCTATGTGGG + Intronic
1010326104 6:74563744-74563766 TCAACTACACAGCACAATGTAGG - Intergenic
1012376367 6:98566350-98566372 TCTATGACATAGCACTGTGTTGG - Intergenic
1021863571 7:24931961-24931983 GCGATGACACAGCTGTATGTGGG - Intronic
1023615027 7:42011180-42011202 TCTATGACACTGCTATCTGTGGG - Intronic
1028399576 7:90410128-90410150 TCTAGGATACAGCTCTCTGGTGG - Intronic
1028957278 7:96708165-96708187 TCTACGACACAGCTCTATGTTGG + Intronic
1032469680 7:132169229-132169251 TCTAAGACCCTGCTCTATGCAGG + Intronic
1039312930 8:36338628-36338650 TCTTCGACACAGTGCTGTGTGGG + Intergenic
1041227611 8:55716318-55716340 TCTACGAAACAGTTCTGTGTTGG - Intronic
1045048581 8:98302320-98302342 TCTACAGCACTGCTCTATGCTGG - Intergenic
1060876419 9:127087109-127087131 TCCAGGACACAGCTGGATGTGGG + Intronic
1186206563 X:7206650-7206672 TGGATCACACAGCTCTATGTTGG - Intergenic
1189373116 X:40445578-40445600 TCTGTGACACAGCTCAGTGTGGG + Intergenic