ID: 1028959206

View in Genome Browser
Species Human (GRCh38)
Location 7:96730244-96730266
Sequence TCACCCTTGGAAAAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028959203_1028959206 -6 Left 1028959203 7:96730227-96730249 CCCACTTTCTATCTGAATCACCC No data
Right 1028959206 7:96730244-96730266 TCACCCTTGGAAAAAATTTCTGG No data
1028959204_1028959206 -7 Left 1028959204 7:96730228-96730250 CCACTTTCTATCTGAATCACCCT No data
Right 1028959206 7:96730244-96730266 TCACCCTTGGAAAAAATTTCTGG No data
1028959202_1028959206 -5 Left 1028959202 7:96730226-96730248 CCCCACTTTCTATCTGAATCACC No data
Right 1028959206 7:96730244-96730266 TCACCCTTGGAAAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028959206 Original CRISPR TCACCCTTGGAAAAAATTTC TGG Intergenic
No off target data available for this crispr