ID: 1028962649

View in Genome Browser
Species Human (GRCh38)
Location 7:96766769-96766791
Sequence GAACCCTATTGGCTTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028962649_1028962652 2 Left 1028962649 7:96766769-96766791 CCAGAAGGAAGCCAATAGGGTTC No data
Right 1028962652 7:96766794-96766816 AGTCATAGGCAGCCAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028962649 Original CRISPR GAACCCTATTGGCTTCCTTC TGG (reversed) Intergenic
No off target data available for this crispr